S03036-01_N24
Seqid S03036-01_N24
Sequence >S03036-01_N24.phd
GNNNNNNNNNNNNNNNNNGGANCNAANNNNNGGGCGATTGGCGGCCANTCGGCCGAATTG
AGCGTAATAGAAGACTAGACACCTCGATACAAATAATGGTTACTCAATTCAAAACTGCCA
GCGAATTCGACTCTGCAATTGCTCAAGACAAGCTAGTTGTCGTAGATTTCTACGCCACTT
GGTGCGGTCCATGTAAAATGATTGCTCCAATGATTGAAAAATTCTCTGAACAATACCCAC
AAGCTGATTTCTATAAATTGGATGTCGATGAATTGGGTGATGTTGCACAAAAGAATGAAG
TTTCCGCTATGCCAACTTTGCTTCTATTCAAGAACGGTAAGGAAGTTGCAAAGGTTGTTG
GTGCCAACCCAGCGGCTATTAAGCAAGCCATTGCTGCTAATGCTTAAACTCACCCAGTGA
CCGATATATTGTGTTTCTATACTGTGTTTGTTATATATAGTTTACCTTTTTTAGACAAAA
GGACAGAATGATATATTATCCNAAAAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAGA
GGTAAGGTAAGTAATTATTCAAAAAAANGGAAANACGGGCCATAAGGGCNNCTCCNCGAA
TTTTGTGGGGGGGGGGAGNAANGATNAGNATAGTCATGTTTTCTGNAACACGGCGGAAAA
TGGGTTCNGGGGATAGGCNGTNAAATGTAGGGAAGANANGAAAAATNGAAAAACAGTNCN
NCAAAAGCAAANAAGGAAAGGGNGNAAATATNNGNTAAGCATGTTGGAGAACAAAAATGA
TAGGGCGCCGNANNNCCANACNCAAAAAGNCNTNCATGCACCCTNGGANGCTNTNACAAN
GNNATAAGTTCAANNA
Quality >S03036-01_N24.phd
11 4 3 3 3 2 3 4 5 4 4 5 3 5 3 5 3
5 8 9 9 6 8 7 10 8 5 5 5 5 6 16 21 19
12 24 30 18 24 26 15 13 26 28 13 13 9 6 29 19 16
18 27 21 13 16 11 18 26 17 11 12 17 26 29 29 29 30
29 13 26 22 21 42 21 32 32 28 31 37 36 42 36 35 30
11 11 18 11 26 15 16 30 42 24 24 32 39 27 32 32 27
44 39 36 21 27 27 33 28 18 21 35 27 30 39 43 35 28
25 47 60 40 44 47 44 40 17 9 16 28 42 54 47 47 47
35 42 47 50 60 47 47 54 47 47 47 45 50 57 58 63 63
63 52 57 60 58 63 57 52 57 57 52 47 52 52 60 57 52
52 57 52 57 57 52 52 52 60 52 52 57 52 58 60 57 57
57 57 52 52 57 57 52 57 63 63 57 52 57 52 52 57 57
52 52 57 52 52 52 57 52 52 52 57 57 52 60 60 60 52
52 59 57 57 57 57 57 52 46 60 42 47 60 60 47 60 46
44 42 30 47 42 47 40 48 52 52 63 63 53 53 52 54 47
60 57 52 60 57 57 52 52 63 57 57 60 53 53 58 63 52
52 60 63 60 58 57 63 58 46 63 54 60 58 60 52 57 60
53 57 60 57 58 57 52 63 63 63 60 58 60 57 60 52 52
52 52 60 58 60 58 52 57 60 57 60 60 52 57 57 57 48
57 52 57 52 57 52 47 57 57 57 59 57 57 52 60 52 60
47 57 57 57 52 48 60 52 60 47 52 57 52 52 52 52 52
47 57 48 58 47 52 52 52 40 60 60 57 52 57 57 57 60
60 57 48 48 53 48 45 47 47 53 44 43 52 52 52 53 52
57 57 57 57 60 52 52 48 60 57 58 57 60 52 48 57 60
60 57 53 52 57 60 52 52 57 52 57 52 52 57 53 52 57
60 60 57 52 60 53 53 53 44 53 53 53 53 53 44 30 43
53 57 46 60 47 47 45 60 45 39 53 53 53 37 37 39 28
27 40 42 23 35 37 27 24 42 34 42 32 31 22 12 15 27
19 20 21 23 11 9 11 23 16 10 28 40 11 11 13 14 31
18 9 18 20 40 41 35 14 6 9 9 12 11 8 9 11 9
9 10 11 20 23 17 9 10 9 10 10 11 13 19 9 11 19
19 15 14 14 18 16 18 11 11 14 26 14 11 9 14 10 9
13 9 13 8 11 9 17 16 15 14 14 11 11 9 10 9 11
23 25 11 12 24 17 6 9 11 24 30 13 7 11 9 11 27
10 13 16 18 18 30 26 18 11 9 9 7 6 9 8 9 9
6 9 11 10 9 14 14 14 13 14 9 10 10 9 18 10 14
9 10 14 10 13 12 6 10 12 6 10 9 12 7 9 10 7
10 10 18 11 11 9 8 10 10 9 9 13 11 11 12 12 6
10 8 9 9 10 10 8 9 10 10 9 11 16 24 17 13 14
11 13 9 9 7 11 11 12 14 21 15 10 15 11 9 6 10
12 6 14 11 11 9 12 10 15 15 11 12 15 19 9 13 7
10 6 9 14 16 9 20 11 9 6 8 10 11 11 12 15 9
9 9 8 6 13 6 6 11 13 13 15 14 19 11 9 9 9
5 12 9 11 9 11 9 9 11 11 11 6 11 6 11 23 16
12 12 8 6 6 9 7 12 10 14 8 11 9 15 9 11 9
11 10 10 9 10 11 9 9 11 9 20 16 9 11 9 8 9
11 10 11 14 13 21 16 9 6 9 6 6 6 10 9 11 6
9 9 6 9 17 12 37 37 16 14 6 8 6 9 7 9 9
11 10 9 17 14 13 24 10 7 9 9 9 6 11 8 8 6
9 6 8 14 10 9 6 14 6 6 9 9 9 8 9 9 9
9 10 14 6 6 8