S03036-01_O03
Seqid S03036-01_O03
Sequence >S03036-01_O03.phd
TNNNNNNNNNTNNNNCNNNNANTATGNNNGTCNCCGGCCTNTNNNNNGNNTNTTGCCATG
NACTANTNNTATANNNCNNCNNTNNNNNNNNNNNGCGACGGGGGGTGGGAGAAGTCNNNN
NNNNTGTNNTCAATGTCAACATTTCTAAGGAAAGTTGTGAANNTTCTNGTGNAACANTGA
GAAAATTCCATATGTTGCNCCNNCACACNNNGANTCCACCNAGTTGGATATNTGGNNGGA
GGGATGTAAGTTACTTAGTNTAACAAATCTAAAGATCTCCTACGGGCAAGATTTGGGACT
GAGTTCCATATTACAAAACGAACATAGTATTGCCATCCGCNNACGCAGNGCGGGGNAGGG
GGGGGGGGTTTTTNNATATTTGTTACTTNATAGTGGAAAAAAAAAGNCGGCNATAAGTAN
GGTTANCAAACTNTAATATGGGGAGAGGATNAAAGACCCNCGCNCNCNNANGCAGGAGGN
TNGAGAGAAATTAGGGTTGATAGCGCCCAAAAATNANTGAAGAAGCCNTGCTTTCTTACC
TNNATANACAGGTCACCAAAAAAATATGNNNTNGGACACNGAAAANCNAAGCNACCGNAA
GCTGCGAATGTATGNGAAAAAAGGCGAAAAATCNTAATGTCTNCTCNTACTTNCGGTNNA
ANTGCGNGNGGGANNGGNNTTCTCTTTNANTTNATGCAAANTAANCGGNANCACGCGTGA
GAGTNTGTGGTGAGGTNGNNNAANNATNNNTCTTTATTCTCAGNNGATNAGAGGANAACC
CAAATTTGNNCGCNANATTAANGNANNACNGTTCNTAGNTNCN
Quality >S03036-01_O03.phd
11 2 4 4 4 3 2 3 3 2 14 5 3 2 6 8 2
5 7 5 9 6 8 9 8 9 5 5 5 9 9 9 6 19
16 22 21 11 9 10 5 28 7 6 6 7 7 9 7 5 15
6 14 9 9 8 12 14 20 14 6 9 9 11 15 7 10 6
7 10 16 8 8 7 7 7 8 3 3 8 6 3 8 3 5
5 5 5 3 5 3 5 6 5 8 15 9 12 9 9 25 9
8 9 14 9 13 9 9 10 9 9 10 10 12 9 5 5 6
6 7 6 6 7 26 9 10 7 7 20 23 10 15 17 10 9
9 9 9 9 14 22 27 13 35 11 9 22 9 12 20 16 19
25 34 10 9 9 8 9 12 7 7 10 17 13 16 6 13 12
9 6 12 14 9 13 6 10 20 24 10 20 35 26 26 31 43
18 14 8 28 19 27 24 27 24 10 11 7 10 27 6 6 9
9 11 9 8 7 7 6 11 11 6 9 14 9 11 9 10 7
8 19 9 14 28 9 8 8 9 9 6 8 9 14 6 6 9
12 11 24 19 9 8 14 9 12 11 11 13 27 24 15 19 10
8 11 10 9 6 11 12 14 23 9 41 53 36 53 34 10 16
12 10 40 16 19 13 10 19 13 19 24 11 14 13 18 12 11
16 10 9 9 8 8 9 9 9 14 28 19 28 19 40 30 17
34 16 18 9 18 11 24 50 9 8 22 23 14 37 19 19 17
28 9 9 8 9 37 18 14 11 8 9 9 12 11 10 8 8
7 6 8 9 20 12 12 10 6 10 10 9 10 10 14 6 9
9 11 14 18 10 19 19 11 9 35 20 9 27 35 35 9 6
6 9 9 11 19 21 9 11 18 14 12 19 9 10 6 14 10
9 10 11 12 9 9 12 34 20 32 35 13 11 11 12 6 11
11 10 10 6 11 14 19 16 23 14 8 6 12 18 18 10 10
6 9 10 8 12 10 20 6 9 11 9 14 9 9 12 17 10
9 11 14 10 11 21 9 9 6 14 9 12 9 19 10 11 8
6 8 9 10 6 11 6 9 6 6 9 6 9 9 12 11 11
9 8 9 7 8 7 9 10 10 9 10 9 11 24 14 15 9
9 11 9 9 21 26 24 12 18 11 9 9 10 9 9 9 9
10 21 8 8 6 18 6 9 10 10 11 8 13 11 12 9 14
6 9 10 9 9 11 9 10 12 18 10 16 12 10 6 7 11
15 11 6 9 10 9 11 10 9 12 10 8 15 15 10 15 14
17 11 10 9 9 12 10 6 6 7 10 6 10 10 9 9 9
10 6 11 11 9 9 9 6 9 7 13 9 9 11 6 9 12
10 9 6 11 21 11 10 10 10 9 8 10 10 9 9 9 11
9 14 7 10 10 11 19 34 11 14 16 16 12 9 18 21 9
18 11 9 9 6 18 10 14 14 10 11 10 9 6 10 9 11
6 11 9 10 11 8 6 10 16 14 11 6 6 10 11 7 9
10 18 11 6 9 6 8 11 16 9 6 6 10 10 6 7 10
9 9 9 9 9 9 11 6 9 7 10 11 6 9 10 9 9
13 11 9 7 9 11 9 6 9 9 9 7 9 6 9 11 10
9 9 9 11 14 10 16 14 9 11 6 9 9 11 10 9 9
11 9 15 24 9 6 8 6 6 6 14 9 6 6 10 11 6
6 6 9 9 14 8 14 10 9 8 9 9 9 9 10 6 6
9 12 11 6 11 8 9 12 11 8 6 8 11 11 10 8 14
16 20 9 9 10 8 6 6 11 10 11 6 16 6 14 9 11
14 9 6 10 6 12 7 6 10 8 6 9 10 11 11 7 10
9 8 5 8 7 9 5