S03036-01_O05
Seqid S03036-01_O05
Sequence >S03036-01_O05.phd
NNNNNNNNNNNNNTTNNNNNCGNNNANNNNGNNGATTGGCGGCCAAATCGGCCGAATTGA
TCTTANNAGATTGAACGAACATTCTGTTACCAACAAGAATATGTTTATCACATCAGTTTA
AGCATGCCTCCAAGAAGTATAGAAGAATGGTTTTACTACAAGTTACTGAGTAGTCCAGGT
TTCCATAGATTTGTACGCAAGGTATATAGGAAAGTAAATGGTATTAAAGAAGATCCTTTC
ACTGACCAATCAACTGCTTTTCAATATCTTTATAAGCCAACTCCACGACAAAAATTTAAG
GCTTTAAGGCTTTTATTTTGGGATGAAATGAGATCTACTTTTGGGTTCAGAAGGAGACTA
GGAGACCGCTTTAAAAAAGATTAATTCATCCTTGTCTGATGTACAAGAACTATAAAACAG
ACAAAAATACNTTTTGNGTGCATTTCATACNNAAATCACATTTNNNTAGGNCATCCCGNC
GNGGGGTGAAGGAAGATAGNGGNTCTATTTGTTATCCTTATTTAAAACCGAAATACGGAT
AGAAACTATATAGAGTTTGATGCNNTNGTAAGAAANTAAAGAGNACTTTCCTTTTNCACC
CGCGGGGGNNGAGGGAGGANANGTTGAANANTANTNNGATATAATGAGANAACACACGCC
ACCCGTCTCTCTTGATGTGTGAGTGANAGAAAAGAGAATNANCACACTCTCTCTCCTCCT
CACGCANNGAGAGGAGGAGCGGGTAAAAAAAANGNNNANNNCNCAATAAGATATAAATAA
TAGGAAGANGAGCATNCCTCATCATTGTATCCGNACGAAGAGAAAAGAAGGAGAGAAAGA
ATACTCCCCNGNCATCCCACGAANANGGAGGGGAGGGGGATGGTAGAAATATNTNATCTA
AAAN
Quality >S03036-01_O05.phd
3 3 2 4 3 2 2 2 3 4 3 4 5 9 8 5 5
7 7 5 10 9 3 3 3 8 7 5 7 5 11 7 6 25
17 14 13 27 14 12 24 27 14 17 11 12 12 36 29 30 24
20 20 18 21 10 16 30 30 12 18 32 37 31 9 7 7 9
28 20 13 30 34 22 32 31 35 35 27 35 32 38 36 32 21
29 28 26 22 31 28 21 28 31 16 21 20 24 20 28 30 29
31 25 26 20 25 28 29 21 33 28 41 36 35 35 54 49 35
42 23 45 49 22 35 35 32 35 40 35 32 22 35 38 39 40
42 51 42 54 42 42 50 54 50 49 32 27 53 42 34 46 49
43 49 42 42 57 57 49 45 53 51 45 46 50 49 53 44 45
44 49 43 42 42 39 42 44 49 49 43 43 46 46 49 57 54
49 53 46 46 46 46 46 42 45 50 53 44 53 51 53 50 49
49 46 50 50 46 46 50 60 60 60 49 49 43 46 63 63 63
58 63 54 50 49 49 50 60 49 49 42 44 35 40 43 46 60
52 57 60 52 57 57 63 52 52 57 63 60 57 57 57 52 57
43 47 60 57 57 57 52 47 58 52 57 58 60 60 60 52 57
57 57 52 52 57 52 57 57 57 58 57 52 57 57 57 58 57
44 52 52 60 57 57 57 52 47 60 52 53 60 48 43 48 42
60 52 52 57 57 48 43 52 60 47 57 52 47 57 60 57 52
31 40 42 63 48 52 52 57 52 52 57 52 47 37 48 60 60
60 57 57 57 57 60 60 48 46 45 37 21 30 44 29 22 30
25 20 16 20 44 39 35 32 17 21 21 48 60 53 35 45 57
52 44 32 31 45 35 26 35 27 20 30 39 21 27 32 19 19
34 53 53 42 35 34 36 53 33 41 14 24 13 18 53 13 39
44 22 16 35 31 35 46 53 41 17 12 13 23 20 16 17 17
28 23 18 12 11 7 9 14 13 22 15 6 9 11 36 19 19
28 26 20 18 15 13 16 9 7 7 22 24 19 23 22 14 13
10 18 13 9 6 6 6 10 8 10 11 6 9 11 11 11 9
9 10 6 9 19 6 10 9 10 9 9 11 9 19 9 11 12
9 10 10 10 26 9 6 11 11 6 16 9 13 11 17 20 26
9 9 19 13 10 9 11 9 19 13 23 12 9 15 13 19 26
10 11 9 10 15 20 9 9 11 9 11 16 19 22 16 11 11
12 12 10 10 10 9 10 9 9 15 9 11 10 9 9 9 12
12 12 6 7 9 7 8 9 9 12 8 27 41 12 6 12 24
11 17 10 12 9 6 10 11 9 9 9 10 10 13 12 9 9
5 18 8 21 10 9 9 9 17 17 15 35 29 7 7 9 8
9 21 14 11 32 22 14 7 8 6 9 10 9 11 10 9 6
9 7 8 9 6 9 6 7 10 9 15 14 18 18 16 11 9
10 9 9 6 15 11 10 10 12 17 14 11 10 13 12 14 16
8 12 25 18 17 12 13 18 16 17 12 12 10 12 17 14 9
11 9 11 11 11 11 6 14 12 28 20 10 31 19 28 15 10
11 13 6 9 7 10 12 11 10 19 10 11 12 14 8 11 12
28 26 14 19 11 10 9 12 11 10 12 11 7 7 10 11 11
11 15 9 19 11 12 14 14 8 9 14 16 9 15 16 14 11
19 18 9 10 7 10 6 7 7 9 7 6 7 9 7 8 14
13 13 21 11 16 26 9 11 11 19 29 18 14 21 16 14 21
8 18 17 10 14 19 7 10 11 9 12 10 11 7 9 11 15
15 8 8 16 21 16 20 15 14 10 14 11 13 14 7 13 8
19 15 14 11 31 8 21 22 13 16 14 11 8 10 11 11 14
9 9 14 30 31 9 14 9 8 9 13 18 29 20 17 13 7
11 7 14 11 12 9 9 16 14 23 13 13 17 7 11 7 15
13 14 23 22 18 11 9 11 27 21 22 29 15 11 18 18 9
9 11 11 13 12 12 14 10 7 14 6 8 20 12 14 20 15
9 9 6