S03036-01_O06
Seqid S03036-01_O06
Sequence >S03036-01_O06.phd
NNNNNNTTTNNNTNNNNGGCNNNANCNANNNGGGGATTGGCGGCCNATCGGCCGAATTGA
GGGCACACAGCAAACAAAACTCCACGAATACAATCCAAATGAGTTCCGTCAATAAAGATA
CTATTCATGTTGCTGAAAGAAGTCTTCATAAAGAACACCTTACCGAAGGTGGTAACATGG
CCTTCCACAACCATTTGAATGATTTTGCTCATATTGAAGATCCTCTGGAAAGAAGAAGAT
TGGCTTTGGAGTCCATCGATAACGAAGGTTTCGGTTGGCAACAAGTTAAGACCATCTCCA
TTGCTGGTGTTGGTTTCTTGACAGATTCTTATGATATTTTTGCCATTAATTTGGGTATCA
CTATGATGTCCTACGTTTACTGGCACGGTAAAATGCCAGGTCCAAGTCAAACCTTGTTGA
AGGTTTCCACTTCTGTTGGTACTGTTATTGGTCNATTTGGTTGTGGTANGTTAGCGGATA
TTAGAGGACNTAAGAGAATTAATAGAATGAAAGAAAAATAAGGNTATGGGGGCAAAGAGC
GAACCNCGGAGAGAGGNCGGGATGCCAAANATTCTATAAANAAAGAGAATAACATGGTGG
ANCGGAGAATGTAAGAGTGGAAAGAAGTTAGGGGTGATTCGTCTCTCCATAANCGTNNNA
CAATGGACCCTTTAAGGGAGNACGGTTGNNNGAAAACGCAAGATGGAACNGCTGAAACGG
GACGTCCATANNCNCTTNAANNCATTAAAATGGNTCGGTNCGTGNTAAATNAAAAGGAAA
AATNNGAANNNAGTTAAANANANGGCNNAAGNANGAANGAANATAACGGAGNCCAGNTGT
NANNTCGTGTAGTNNNNNNGANATN
Quality >S03036-01_O06.phd
7 4 4 3 3 3 8 9 8 5 5 7 11 7 5 5 6
15 12 9 7 5 5 8 5 9 7 8 5 6 6 9 13 12
18 8 10 12 25 10 11 21 25 19 15 7 9 16 32 25 27
28 26 20 20 17 26 49 22 18 21 36 27 18 11 27 24 41
33 35 38 44 38 50 44 52 42 46 40 43 54 49 44 11 42
20 28 27 39 35 60 13 42 42 60 38 23 28 35 44 44 44
35 44 35 42 44 35 29 35 12 19 32 29 35 35 42 46 46
44 52 47 47 52 52 52 47 57 60 60 43 60 47 57 57 52
43 44 52 57 60 57 60 52 57 52 60 60 57 52 58 58 60
63 43 45 57 52 57 46 45 57 52 60 60 57 52 39 43 57
52 52 57 60 52 52 57 57 57 57 60 60 60 52 57 52 52
59 52 60 60 51 52 60 60 58 50 45 54 54 60 50 44 60
50 54 52 50 50 54 44 50 60 50 47 60 49 60 50 45 50
54 50 54 54 50 50 49 47 60 60 47 54 60 54 50 60 57
52 38 60 63 52 52 57 60 52 52 52 52 52 52 47 52 52
60 57 52 52 57 47 59 52 52 57 52 52 58 52 60 54 52
52 52 52 59 57 52 57 57 57 57 42 58 52 60 52 52 57
60 52 46 52 42 60 57 52 57 52 44 52 52 60 52 57 57
52 57 52 52 46 52 52 52 57 52 60 54 60 57 52 60 26
60 52 39 57 60 57 48 52 52 57 52 46 52 46 57 57 60
57 48 40 48 35 52 57 57 52 52 57 57 57 52 52 52 48
48 60 57 52 52 52 60 57 52 42 43 48 60 57 54 60 53
48 57 57 45 60 52 60 48 34 29 12 29 57 57 52 48 43
10 10 12 52 52 52 53 45 53 39 53 52 39 43 35 57 57
53 52 52 53 53 53 53 53 40 53 53 40 37 53 52 42 45
53 53 37 33 53 53 52 45 53 53 28 33 45 28 33 42 41
33 35 34 34 27 18 21 27 28 11 14 5 19 11 16 9 16
25 20 15 9 12 17 15 12 10 6 10 9 10 21 9 11 10
18 14 9 29 17 14 9 9 9 14 14 10 17 6 9 9 28
9 34 10 23 18 10 28 12 17 11 12 16 9 11 10 10 10
12 10 10 11 27 14 10 13 20 17 27 12 8 7 13 11 14
18 26 11 10 9 11 20 13 13 21 8 13 12 11 11 14 10
11 7 9 15 11 11 8 20 12 14 8 8 7 11 17 12 16
14 16 20 14 12 16 10 10 6 12 11 13 13 15 18 16 14
13 24 6 15 15 24 27 14 14 9 14 12 14 11 9 14 14
13 12 17 17 18 12 7 8 9 10 14 19 11 9 9 18 11
16 11 12 13 13 16 11 10 23 18 10 11 14 14 10 11 10
16 18 19 13 10 10 10 14 8 10 16 15 13 9 9 9 14
12 10 10 11 10 9 7 11 10 13 6 6 7 9 8 14 10
10 22 21 18 13 9 9 9 13 26 8 9 11 9 8 9 11
6 10 10 23 23 14 14 14 7 6 6 9 10 11 14 10 8
9 16 10 9 9 9 14 10 9 12 11 11 6 11 9 8 8
10 27 14 9 25 13 9 15 11 11 8 9 9 10 11 9 6
6 10 6 9 8 9 6 10 10 6 6 8 10 11 9 9 13
8 9 9 11 9 6 11 14 11 9 8 6 8 9 9 9 6
8 8 8 11 9 6 9 10 11 10 8 10 10 11 16 18 19
10 7 7 9 11 14 6 6 6 10 9 9 11 10 8 9 6
9 6 9 6 13 9 9 7 6 8 9 9 6 9 7 10 14
9 5 11 11 12 6 9 11 9 9 11 11 9 10 11 6 8
9 10 8 6 11 8 8 6 11 6 6 10 11 10 9 8 10
12 8 8 7 5 5 6 7 6 9 8 7 14 9 6