S03036-01_O07
Seqid S03036-01_O07
Sequence >S03036-01_O07.phd
NNNNNNNNNNNNNNGCCNNNNNNNNNNGGGNGATTGNGCGGCCAATCGGCCGATTGGTGC
CATAAAATAATCACTAACAAATATAAGATCACGCTATACTATCAATGAAGAAACAAATAT
TAATAGTTGCTGCACAAAGTATTTTATGTTCTACTGTTTTTGGCGAGCGAAGTAATGTAG
GCCTTTCCACTGAAGAGCTAGGAGGTGACTCAATTTTATACTTCAATGAAGACCCTATAG
TGATTGAAATCGATAAGAAAGCTATTGACAAGAAGACTCTGGAACAGTTGGCAAGCACAA
GAGACGTTGTTCTTACTGATTTACCGGACACTCTTGAGTTTATAGACTTCAATGAGTACG
CGAAAATGAAGTCAAAATCAGATATGCTACTAGAGTATATCAACGAATACGAATTTGATG
ATTTTGAAAGAAGTTCTGAAGGCGGTCTTGATGAAGAAGAAGAAGAGGAATTAATTAATG
ACTTCAATGCCCAAGCTGAATATTTGGGTAAGCTTGGTTCAAATATAAATGAANGTAGTC
GAAGNAGANANNANTGGTNNTACNTAAACNGGAAACCATATTTTGGAAGTAACACTGCAT
CTACGGGTTCAGGNAAGGATTNNGAAACANNTACCCGTAAATACCACNAGTGAGAGAATT
TTAAATTATTGGTAANGATTNAGAAGANGNAGAAAGGAATGAGTTNACAGCNNNAAAAAG
AGTCGGTTACGNGAAAGGGAGGGGGATANNAGGGGGGCCTACTTCAAANNTCCNNCGTGN
GGAANGGNNAACNAGAGTAACCCGGAGNAGNNAGTAAANNNAAANAAANAACNTTCANCC
GANGAAAGNGGGGAGTGNGGTGTAAAGAGGGCGAGGGGAGAAGGAAATAAAANAAAGNGA
AN
Quality >S03036-01_O07.phd
3 3 3 4 3 3 3 2 4 4 5 5 5 5 8 11 9
7 5 6 3 5 3 5 3 3 3 8 12 12 6 17 11 11
8 10 6 16 11 31 30 12 15 17 23 35 43 47 23 21 31
41 37 16 40 43 21 37 31 26 36 11 41 43 30 34 31 41
38 41 37 30 37 47 44 42 49 35 25 28 47 49 33 35 22
29 36 26 16 42 26 43 49 49 43 35 52 46 43 43 42 46
34 31 29 35 46 26 31 46 50 46 43 50 39 50 49 49 54
57 50 57 54 42 35 35 43 54 50 51 53 53 50 42 50 46
53 46 53 51 49 45 53 53 45 47 43 53 57 54 53 50 49
45 53 53 51 53 53 51 53 53 45 44 53 51 49 51 53 53
49 38 57 49 46 51 53 51 50 51 45 51 53 53 53 57 52
50 39 50 51 51 45 51 46 53 46 47 50 54 54 57 52 28
31 43 51 42 44 53 51 44 53 53 53 53 45 43 43 46 53
63 59 54 50 49 60 49 50 47 60 42 39 49 51 54 60 54
54 54 50 63 45 33 63 63 58 63 46 47 51 60 42 49 60
43 43 43 63 63 49 47 49 60 47 63 63 50 60 47 63 60
63 63 49 42 42 60 60 63 63 63 43 41 43 47 60 50 63
49 50 60 60 63 49 60 59 60 47 63 49 51 47 45 42 50
50 60 51 49 46 60 47 63 47 50 60 63 50 47 63 58 60
49 58 46 46 44 42 44 50 57 60 57 63 52 52 52 52 63
46 57 57 52 63 52 57 57 60 52 52 42 43 60 52 43 47
52 52 52 52 57 52 63 47 45 52 58 57 58 57 60 57 47
57 60 57 57 46 52 60 52 46 52 52 52 40 44 60 52 57
60 52 52 42 57 57 42 57 57 52 42 43 53 47 48 57 57
52 48 48 48 60 60 48 43 48 52 42 42 46 39 57 60 48
48 40 43 48 57 57 43 23 23 16 21 35 52 46 48 25 41
20 47 54 22 42 42 52 52 35 21 60 60 40 19 34 30 16
21 20 12 14 16 16 34 35 42 17 9 16 14 18 22 34 13
9 11 9 18 17 12 28 36 14 10 16 16 34 27 46 24 17
15 20 21 15 9 14 23 9 42 16 14 26 23 31 41 36 27
33 16 28 24 34 46 20 27 19 16 9 16 22 14 11 27 15
10 23 24 14 34 22 6 16 11 18 18 16 23 13 25 27 11
7 9 11 10 6 10 7 6 14 6 14 15 27 16 6 6 9
16 12 6 24 10 12 11 13 7 11 34 27 38 24 11 10 10
11 33 16 10 8 11 10 18 12 14 14 16 12 8 8 19 20
16 9 10 16 10 10 8 12 11 9 9 9 10 9 9 10 11
10 6 10 10 11 10 11 9 10 6 6 9 14 14 19 8 11
6 6 11 9 11 9 15 11 13 23 13 13 9 9 9 9 11
16 7 11 8 15 10 16 14 13 13 14 11 16 14 12 8 15
11 13 13 12 17 21 11 9 9 8 9 9 6 9 10 9 11
7 10 10 25 13 14 16 6 9 6 9 9 9 16 15 11 10
10 9 9 10 9 10 13 10 6 11 13 11 11 9 6 6 6
11 10 8 10 10 14 10 13 8 11 8 10 11 11 10 11 11
6 14 22 9 14 11 9 9 11 11 12 11 9 9 10 9 10
7 7 10 10 11 10 11 12 13 9 9 11 9 10 11 16 12
10 10 13 6 7 11 11 9 6 7 9 11 8 9 6 11 10
11 9 6 9 11 6 6 9 9 10 6 10 12 23 11 10 10
14 11 9 10 9 12 9 10 7 9 9 6 6 10 10 11 8
11 10 7 6 6 9 16 9 6 8 10 12 6 11 11 12 6
12 9 10 11 6 11 10 10 9 6 8 12 11 10 9 6 10
16 11 8 8 12 8 9 6 10 10 8 14 12 13 10 9 14
10 9 10 10 10 11 9 16 12 11 9 24 10 13 10 11 12
10 11 11 8 8 9 9 12 6 9 9 9 9 6 10 10 10
6