S03036-01_O09
Seqid S03036-01_O09
Sequence >S03036-01_O09.phd
NNNNNNNNNNTNNNNCCNNANNNNNNGAGGNGANNGGCGGCCAATCGGCCGAATTGGAAG
AAACTAAATATACATAGCACCCNCNNNNAGGATGTCAAAACTATCGTCTTATCCTCATGC
CGCCNNTTTTATAAATATGGAAGAACCGCCAAAATCTAAAGAGTTTTTCGATGATCTTTG
TGCCGTCCCTAATTTACTCAAAAGACGTTTTCCAAACTCTCGAAGATCGACGCATTATTG
TGAGGCTTTAAATTATTCTAGGAAAAAGCTTCCTGTTGTGTTGTCTAAAATGACACTGCA
AGAGTTGAGGCACAATATGTCAACATTTTTTTTGCAGGAAAAGGATCAAATAAATATTTA
TGACACCTGTAAGGTGATAGACATGGGGGACCGTGTCTTGCTCGAAACGATACGTCCACA
GCCAAGAGATTTNTTTGACAAAGTGCATGCTAGTAATAGGAATTTCCAAGTAGAGACAGT
GGGGGGAGAGNAAACCATAAAAAAGNGTTTTTTATGGAGTAANAACCTGGGGAGGGTGNA
AAGATACAAGCGTATATTNGAGAAAAGGGTTATAAAAAANACAAAAAGAGAAAANAAAAA
AGCTATAGNNAACGGGAAAANNTTGGGNGANAGNGAATGAATAGGNNGAAANATGATAGT
NTTTTCAAANNTNGNACAAAGTNNNANCNNTTAATATGAGNATNAAGGTTNTAANAAANA
CNACNGCNGGAAAACNAANGNAANGGNANAAAANNAAGCAANCAATTATGTTANNTAAAN
NAAATNANCNNNNCNANACNNGCNNGAANCNAGAAAATAGGGAGAGANGNTTATGACAGT
NCATACATCTTTCNCCGTACAATNGAGATAGCGNNNTATANNNANTGNCCTC
Quality >S03036-01_O09.phd
4 3 3 3 3 5 3 6 5 5 8 5 6 5 6 12 10
7 6 9 5 5 3 7 7 7 9 10 10 10 7 10 10 5
3 8 15 10 35 24 19 12 10 8 16 29 23 16 23 26 16
20 13 26 37 28 15 16 22 30 25 12 23 28 36 26 28 28
35 47 35 46 42 31 49 45 49 44 42 42 49 10 5 9 6
6 5 6 15 21 35 27 23 59 46 39 25 46 54 30 35 36
42 43 50 54 59 59 50 43 54 54 54 52 49 50 42 54 54
57 51 39 42 22 7 7 8 57 60 50 54 54 54 60 60 60
60 63 63 63 63 63 49 63 50 47 63 58 58 45 52 60 58
58 57 63 58 57 58 60 63 63 59 63 58 58 60 63 52 60
63 57 63 63 52 60 60 60 58 58 58 63 63 63 60 57 63
63 63 63 63 63 58 63 53 60 57 57 63 46 60 57 60 57
52 52 52 63 63 63 63 57 52 27 63 63 63 63 58 63 63
60 52 48 48 58 52 53 57 52 52 60 63 60 58 52 60 48
57 63 60 63 63 52 63 52 63 63 52 52 60 63 52 58 60
52 57 60 57 59 59 60 58 63 63 60 60 57 52 63 57 57
60 60 58 60 60 58 57 63 53 58 63 57 57 52 57 57 60
57 52 60 52 57 53 57 60 57 53 43 43 53 53 53 53 60
63 53 53 41 37 37 53 35 53 53 60 53 53 53 53 57 57
60 60 52 60 53 53 60 47 45 42 37 53 35 37 53 53 45
35 35 32 57 40 33 60 46 45 53 47 35 27 41 42 34 52
57 52 53 52 48 53 33 20 32 42 53 46 53 14 14 13 34
28 26 46 27 12 11 33 34 28 53 41 31 24 42 38 32 24
35 32 24 33 13 18 9 10 30 16 26 40 32 35 28 9 12
10 10 9 11 14 10 13 19 14 9 12 11 9 11 14 9 18
10 10 9 12 16 42 28 6 23 11 9 11 11 10 16 15 28
11 11 8 19 12 11 10 9 11 14 14 18 13 12 11 9 10
9 10 9 10 14 11 11 11 8 14 10 15 10 13 19 10 17
23 14 9 9 9 9 11 11 11 10 9 13 9 11 6 16 11
8 9 10 10 11 9 11 11 11 14 13 9 6 8 11 11 12
11 9 9 9 10 10 8 8 10 11 9 9 6 20 14 11 9
10 9 14 14 11 13 21 15 12 11 13 7 11 9 9 14 14
9 13 10 23 9 9 12 15 12 14 10 10 15 12 7 18 11
11 11 10 10 9 11 13 9 9 9 11 9 8 11 21 21 20
15 6 11 9 19 12 20 17 15 10 8 10 13 22 17 10 6
13 10 11 15 16 15 10 10 13 19 17 11 15 7 6 10 10
11 9 16 24 18 12 8 9 6 6 9 10 8 9 14 6 9
11 6 11 8 6 11 11 11 10 15 18 14 11 21 11 10 6
6 9 9 22 11 6 18 8 11 9 9 9 9 9 6 11 9
8 11 9 12 14 14 6 7 8 6 11 6 13 9 9 8 14
9 9 6 6 6 9 6 9 6 6 11 9 11 9 12 10 14
10 9 10 6 9 9 6 9 8 9 10 9 9 6 9 8 9
6 9 9 9 6 8 11 6 9 8 6 8 9 6 8 11 11
9 8 9 9 6 8 9 6 18 6 8 9 6 9 9 6 8
5 8 8 9 9 6 6 9 9 8 8 9 8 6 8 8 12
13 9 11 8 9 11 11 10 6 6 11 12 14 12 6 6 8
11 11 11 6 19 7 8 6 6 6 6 9 6 10 7 9 10
6 6 10 9 6 6 10 14 23 7 8 6 9 14 14 11 14
14 14 9 9 14 11 14 9 14 9 10 6 9 6 10 10 11
8 11 9 8 18 8 9 6 9 18 14 14 9 9 9 10 14
23 9 10 6 9 11 15 12 11 8 10 14 9 6 14 11 10
11 10 19 9 10 9 6 6 7 9 9 9 9 6 6 6 11
5 9 9 6 11 10 14 8