S03036-01_O12
Seqid S03036-01_O12
Sequence >S03036-01_O12.phd
NNNNNNNNNNNNNNNNGNNNCNAGNNANANGGNGATTGGAGGCCGNTCGGCCGAATTGAA
GGAAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAATTAAAAATGCAATTCTC
TACCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCCGCTTCTAACATTACCAC
TGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTTCCTGTGAGGACCACGT
TTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCGTCACCGTAAATGACGT
TATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAGCACCAAAGAATACCAC
TTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAAAGCCAACTGAAAAGCC
AACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTGGTGCCGCTGTTAAGGC
TTNGCCAGCTGCCGGTGCTNTGTTGGCTGGTGCTGCCGCTTTATTGTTGTAATTTACTCA
ACCTTTTCTTTCATATATTTTTAGAAATATGGTTAAGTACTTTTCCGTCAATACAGCTTC
CACAAAATCCTTTGATTTCAATTAATAAGATATTCTGGTTATTTCTTATTCTAATTCTAG
GAGGCAACACTCCATAACTAAATGTTTATTTATAATAATAATNAAAATAAAAGTAAAATC
CCTTCCGTCACACGGCGGGTGGAGGGTGAGGGATGGAGCTGGGTGAATNNTATTTATAAA
ATAAAAAACAAAAAAAGGAAGATAAAAGGTAAGGAAATCTTANGTNGAAAAAAAAAAGGG
NNNTATATTATTATACACACACACGGGGCNGCGGGGAGANGNGAGGGTTGTGNNTAGGTG
A
Quality >S03036-01_O12.phd
6 5 5 6 6 7 7 2 4 5 5 5 5 6 6 6 14
7 6 6 12 7 9 8 5 5 14 6 9 6 17 9 6 15
12 12 15 28 16 9 14 20 8 10 9 6 14 20 30 24 17
26 29 31 12 28 28 18 18 18 20 27 14 12 21 31 26 15
19 13 12 14 16 17 18 20 17 21 16 38 30 16 16 35 10
16 22 26 11 19 20 30 22 27 19 25 44 29 27 38 13 20
22 22 19 19 12 12 12 15 11 36 44 31 22 33 44 33 33
35 33 35 44 42 35 28 35 23 44 44 44 44 31 35 35 28
24 24 42 39 35 28 35 35 35 44 27 27 35 34 33 33 24
27 44 35 35 35 44 44 44 44 35 33 35 35 33 35 23 27
39 36 40 47 42 47 39 35 27 33 27 42 35 35 33 44 33
47 28 35 42 42 25 14 34 28 23 44 26 26 42 35 35 40
22 19 29 31 31 24 40 42 25 24 22 22 25 22 19 16 14
22 25 21 24 21 35 47 35 42 32 27 44 32 32 28 25 24
24 35 28 21 44 18 19 24 25 35 33 24 24 27 35 24 27
44 35 35 33 27 26 17 14 20 39 40 43 63 42 27 29 21
28 23 20 35 24 26 24 12 19 27 27 28 24 21 18 27 27
27 24 40 12 22 20 28 35 27 27 27 42 33 35 29 31 35
29 12 13 12 12 17 35 39 30 36 35 31 36 16 28 22 27
54 57 39 31 27 36 36 42 36 44 38 18 23 19 33 39 22
29 26 28 38 22 15 26 23 18 22 32 28 35 28 28 39 42
39 39 20 27 26 33 35 15 20 22 31 35 31 22 26 10 12
18 38 36 30 22 28 21 18 15 21 19 29 29 27 27 33 33
33 35 21 39 27 36 34 31 39 35 36 39 43 33 35 13 18
14 21 21 29 36 24 15 15 22 22 18 21 11 26 15 18 13
17 35 27 21 30 35 43 26 30 28 30 28 36 32 27 17 29
22 34 39 46 38 32 37 18 23 27 28 28 27 27 29 16 29
31 29 21 38 30 18 18 33 19 19 18 35 28 36 21 20 18
27 19 30 22 29 8 6 13 25 35 36 32 20 17 21 20 18
32 42 26 35 33 10 6 16 35 15 22 35 29 12 22 35 39
22 34 27 36 30 25 18 17 27 22 39 22 27 26 25 17 11
22 35 27 35 44 21 35 47 31 42 46 24 45 35 15 29 27
27 24 15 27 47 51 27 13 19 28 28 60 35 35 35 28 24
35 60 44 59 47 44 9 27 23 32 32 44 52 46 46 44 34
42 29 44 47 44 34 34 35 44 44 46 30 25 19 17 24 17
17 46 35 47 46 47 31 28 31 35 46 44 25 28 28 27 31
35 8 29 18 20 22 46 27 35 34 28 39 46 29 35 46 27
44 41 33 32 57 47 41 46 16 15 13 20 13 26 53 22 33
33 46 33 36 27 32 19 19 12 19 14 16 24 17 19 16 14
20 10 26 22 14 15 16 31 32 13 10 24 24 27 14 20 12
53 19 14 16 11 26 45 53 41 50 18 28 28 20 33 17 18
27 14 17 11 10 6 37 18 14 16 16 26 53 13 9 11 15
12 23 15 16 10 12 11 19 13 11 11 10 16 13 11 11 13
16 13 18 14 18 11 11 13 10 11 19 13 13 15 14 13 17
13 13 15 12 11 10 11 13 13 13 14 11 13 14 21 15 19
9 12 11 6 6 11 11 14 11 11 14 11 16 11 21 23 11
14 11 14 11 14 9 11 16 17 19 14 32 12 13 18 17 14
10 12 13 21 16 11 11 11 22 26 14 10 13 32 32 17 12
9 10 9 10 11 9 6 11 9 7 10 14 10 9 15 12 9
11 10 9 11 9 9 11 6 7 6 9 9 14 10 10 11 15
15 13 14 24 13 18 14 11 11 10 12 11 8 14 14 14 11
9 8 6 8 13 14 22 12 14 9 17 12 6 12 7 9 10
12 10 10 10 10 14 8 9 6 6 8 9 11 11 10 19 11