S03036-01_O13
Seqid S03036-01_O13
Sequence >S03036-01_O13.phd
NNNNNNNTNNNNNTNNGCNNNNNANNNNTNGGCGATTGGCGGCCAAATCGGCCGAATTGA
GCGAAGCCCCTGAGTCTTCTGTCCCAGTTACCGAATCTAAGGGCACTACCACCAAAGAAA
CAGGTGTTACTACCAAACAAACCACAGCCAACCCAAGTCTAACTGTCTCCACAGTCGTCC
CAGTTTCATCCTCTGCTTCTTCTCATTCCGTTGTCATCAACAGTAACGGTGCTAACGTCG
TCGTTCCAGGTGCTTTAGGTTTGGCTGGTGTTGCTATGTTATTCTTATAAACGGTGGTGT
TTGACACATCCGCCTTCTTAATGCTTTCTTTCAGTATTATGTTATTTTTTTGTTATTCGT
TTTTCACTTCTAGGCTTTTTGACAGACTAGCCCCGTTATACCACCATCTTTGTGGGAAAG
CCCCTAAATTGCCCTGAGCAGTATCGTTTCATGTCTAGTCTCTTTAAAGATGTTTCTTAC
GCGTTGCGTGTAAAACATCCTCTCATTCAAGACAGGGTTTTCTAAAAGCAATAGGGGTAG
TTTAATAATTCTTATATAATCATCATATACACTATTTTTAGTTCTTAATTCTTTAATACA
AACTTNATTAATGTGCTCTCAAAANAAAANNAAAANAAAAAAAGTACCGGCCATAAGGGC
CACCTTGAGTATTCTATAGTGTCACCTAAAAACTTGGGTTCCGCTCAAATTGCACCAAGA
TAGAGGCGGGAGAAAAAGTTNAAAACTGGGGGTGCCTAAAGAAGGGACTAAATAAATTAA
ATTAGGTTGAGCACAAGGTCCACATCCACTACGGAAAAAANCATCCCAAAAAAATATCAA
ATGTATCACTGCGGGGG
Quality >S03036-01_O13.phd
6 2 3 3 3 4 6 11 5 5 5 5 6 14 2 6 9
10 7 5 5 5 5 10 5 7 5 7 9 5 12 22 8 16
12 9 23 28 19 12 42 24 16 28 13 13 29 35 35 44 24
34 31 35 31 10 29 41 36 33 31 41 42 28 26 28 35 50
50 39 44 28 26 17 42 45 51 51 52 52 52 49 41 43 32
25 23 30 32 26 42 50 51 43 49 49 49 42 34 37 35 49
42 46 21 35 43 52 49 42 46 52 42 42 54 49 42 42 49
50 43 52 54 54 54 57 49 39 32 39 42 54 50 42 41 46
46 50 44 54 54 49 51 50 54 54 54 57 42 52 57 54 54
42 50 57 57 53 51 57 54 57 52 57 57 57 57 57 57 51
50 59 59 57 51 53 57 53 47 47 50 50 57 57 53 53 57
57 57 57 53 53 53 53 53 43 53 53 57 53 53 53 57 57
57 57 57 57 53 57 59 57 57 57 57 54 57 63 47 63 63
50 58 57 58 63 63 63 63 58 63 63 58 50 58 58 60 46
47 43 20 21 21 38 20 34 49 50 50 63 49 60 58 63 63
42 60 45 63 58 63 60 63 58 50 58 63 58 60 63 63 60
63 44 63 54 63 63 60 63 52 50 63 63 60 58 60 58 58
63 43 63 58 63 60 63 63 59 63 54 63 63 63 44 54 59
63 54 63 63 63 63 59 63 63 63 59 60 50 60 60 50 63
54 63 63 63 54 60 63 63 51 50 59 58 54 50 57 54 50
58 54 54 59 57 59 57 50 54 50 49 57 42 59 59 54 54
54 50 54 54 54 57 57 54 59 57 57 59 59 57 59 47 43
49 57 57 57 51 53 51 50 43 42 54 54 54 57 59 54 57
57 54 51 50 57 57 50 50 54 50 50 43 54 57 54 54 59
59 54 57 57 59 54 54 54 50 53 53 50 49 46 46 49 50
43 57 57 54 57 51 42 51 51 51 57 45 31 54 50 39 43
49 54 54 54 54 54 49 42 43 46 54 50 50 54 42 54 46
46 39 31 28 20 19 27 37 39 35 43 38 42 30 46 46 49
35 38 46 49 33 50 42 40 49 50 37 46 37 50 34 42 49
50 49 29 46 46 46 46 50 42 54 39 49 46 49 42 26 35
42 49 30 43 42 50 49 42 54 49 49 29 43 27 54 50 50
19 34 32 54 38 38 10 49 49 42 42 44 27 42 46 38 27
50 30 32 42 27 43 38 27 43 50 34 38 27 44 42 33 38
30 42 44 42 31 30 27 21 22 27 31 14 19 16 22 36 42
36 39 42 39 42 39 39 39 39 36 27 36 30 10 22 15 12
21 19 22 27 35 24 28 27 22 22 7 15 14 13 18 21 35
44 29 29 27 22 27 21 20 18 27 35 13 6 13 26 9 9
7 7 32 40 18 8 7 22 49 34 40 35 44 35 23 23 24
35 44 19 46 19 18 13 15 16 15 31 23 15 14 23 24 16
16 30 29 20 24 14 46 32 29 32 22 20 35 29 24 17 20
31 13 19 12 19 17 11 31 23 16 13 12 12 13 17 16 23
16 16 15 14 32 15 14 12 10 8 10 23 16 10 12 11 11
11 12 18 22 14 11 15 11 8 15 13 10 23 12 9 15 10
10 11 20 17 32 30 9 8 11 7 10 34 19 11 11 12 12
24 23 13 24 18 18 15 14 15 34 28 17 12 15 19 9 15
11 11 11 8 24 21 19 18 11 18 14 9 11 13 14 16 25
14 10 13 20 20 26 34 10 15 8 9 10 10 10 11 15 8
10 11 9 15 17 12 16 28 26 14 13 21 9 24 9 19 53
46 13 8 9 7 8 10 9 9 14 17 28 17 11 14 15 11
14 13 20 11 11 15 20 30 16 11 13 11 14 11 14 14 13
11 10 14 14 11 14 14