S03036-01_O14
Seqid S03036-01_O14
Sequence >S03036-01_O14.phd
NNNNNNNNNNTNNGNNNNCNCNNNANATNGGCGATTGGCGGCCAATCGGCCGAATTGAGG
GTCAAAGCTCACAGCACTACTACACTCGTTCAACACTCGTTATATATTATCATGCGTGCC
ACCACTTTATTATCTTCAGTCGTTTCTTTGGCATTGTTGTCGAAGGAAGTCTTAGCAACA
CCTCCAGCTTGTTTATTGGCCTGTGTTGCGCAAGTCGGCAAATCCTCTTCCACATGTGAC
TCTTTGAATCAAGTCACCTGTTACTGTGAACACGAAAACTCCGCCGTCAAGAAATGTCTA
GACTCCATCTGCCCAAACAATGACGCTGATGCTGCTTATTCTGCTTTCAAGAGTTCTTGT
TCCGAACAAAATGCTTCATTGGGCGATTCCAGCAGCAGTGCCTCCTCATCCGCTTCTTCA
TCCAGCAAGGCCTCTTCTTCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCCTCTACCAAG
GCTTCTTCCAGTAGCGCTTCCTCCTCTACTAAAGCTTCTTCCAGCAGCGCTGCCCCATCT
TCTAGCAAGGCTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACCAAGGCTCCT
TCCAGTGAAGAATCCTCTTNCACTTATGTCTCTTCGANNANCAAGCTTCCTCCACTAGCG
AGGCTCACTCTTCCAGTGNTGCCTCTTTNNNCGTGTCCCAAAAAAACNATNCNNANGGTC
TAACAAATTATAACGACGTTATTTTTANNNNCTCTAANNNGCTGGAAAGGTTNGAAAGCA
GAAAAANTGNATTTCNTTCTGCAGANNNAAAAATTAAATNAAAGCNTTATNTAANATAAN
NANAAAGAAAAAAGAACANGGTTTNNGAAACGAGTCNCGGNTNTGGATN
Quality >S03036-01_O14.phd
5 2 3 3 3 6 3 5 3 2 11 6 6 8 3 7 7
7 9 6 9 5 5 5 8 5 9 9 7 14 9 10 24 26
11 23 31 15 12 41 31 16 18 21 26 32 40 48 32 37 30
31 28 29 30 35 30 26 28 44 32 30 30 32 30 44 38 38
51 27 37 28 36 37 37 33 29 30 31 42 38 42 43 35 35
35 35 35 35 42 42 22 36 42 36 42 40 43 38 35 35 46
38 35 37 35 31 24 32 30 23 27 34 42 28 28 35 54 30
27 30 26 32 42 42 50 49 39 43 43 39 42 50 43 46 49
43 50 50 42 49 49 54 50 50 54 59 49 49 50 42 42 50
50 51 49 50 49 49 43 44 54 51 49 44 54 50 54 54 53
50 51 50 49 54 54 50 46 54 54 50 50 50 49 43 46 54
54 57 51 57 54 51 50 54 50 54 57 52 50 49 46 49 43
50 54 54 54 43 50 54 50 49 49 50 47 43 44 54 42 46
49 54 50 57 54 54 46 44 46 44 39 50 42 54 57 54 42
33 24 32 34 44 43 46 49 46 43 46 54 54 50 54 54 49
49 44 51 57 59 57 43 50 50 49 49 54 54 50 54 50 42
50 54 54 54 54 54 54 49 53 51 54 54 52 49 49 50 27
50 43 46 42 41 38 50 34 54 50 50 54 50 50 54 50 50
22 54 54 54 54 49 46 43 30 49 49 43 35 49 54 54 43
42 43 50 54 49 57 30 57 49 54 54 42 54 49 43 33 49
49 49 50 35 57 51 49 47 25 50 54 50 35 43 51 49 46
57 57 46 49 49 53 46 49 53 40 37 49 43 54 37 49 35
54 49 42 54 43 49 42 31 46 49 49 50 29 49 49 46 28
49 52 52 37 52 49 35 49 49 38 49 41 46 51 49 52 35
52 46 49 46 49 49 49 52 49 49 52 46 43 52 50 35 52
49 40 31 46 49 28 49 50 49 49 51 49 35 51 46 46 35
42 52 35 49 35 49 35 49 53 38 49 49 27 46 28 35 39
35 21 35 49 35 49 40 37 43 43 43 43 49 43 41 46 26
49 32 49 28 53 36 40 51 40 34 49 32 51 28 46 47 30
46 46 49 37 40 41 29 32 40 32 29 31 32 27 36 21 30
32 30 32 28 50 46 47 46 32 49 26 41 36 35 46 36 21
46 34 46 49 32 40 21 21 35 28 49 36 30 45 36 36 42
26 32 20 32 26 47 17 41 37 36 36 46 28 39 26 21 40
28 30 41 32 29 30 38 46 35 50 34 36 46 25 26 25 23
28 41 28 30 49 29 21 18 13 16 30 36 29 11 26 15 32
16 30 20 41 24 28 26 37 25 19 20 26 19 41 15 26 31
26 24 13 21 27 13 20 6 13 15 31 14 21 20 20 29 16
28 35 26 16 16 23 26 8 5 4 9 5 14 28 18 9 12
11 13 10 25 30 23 34 35 30 32 32 21 30 26 30 16 21
15 29 16 15 13 18 29 17 17 8 22 24 22 9 10 7 10
27 12 12 9 9 32 22 10 6 7 7 15 35 22 26 22 16
16 20 12 21 8 11 14 35 15 9 6 9 11 6 9 7 7
9 6 14 10 14 12 17 14 9 19 12 28 22 19 27 13 15
15 11 9 16 8 17 21 25 24 13 22 20 14 10 9 9 7
7 6 7 11 10 11 15 9 11 7 6 6 8 11 11 14 19
8 9 11 11 13 8 11 6 9 18 8 11 12 9 16 11 16
37 53 13 11 6 11 10 6 9 13 9 14 9 6 12 9 9
10 11 13 13 10 8 6 6 6 11 11 15 23 14 8 11 13
13 28 11 7 10 14 9 11 8 6 11 9 21 18 7 9 20
11 6 11 10 8 9 6 6 9 6 14 9 10 11 9 11 18
16 11 9 13 9 11 11 9 6 8 8 11 12 12 6 6 9
11 15 10 10 11 9 23 14 11 7 8 11 9 6 9 6 9
10 9 10 9 6