S03036-01_B12
Seqid S03036-01_B12
Sequence >S03036-01_B12.phd
NNNNNNNNNNTTTNNNGNNNNANNNNNGGGCGATTGGCGGCCAAATCGGCCGAATTAGAA
AAAAAAAAAAAGTACCGGCCATAAGGGCCAGCTTGAGTATTCTATAGTGTCACCTAAATA
GCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTC
CACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCT
AACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCC
AGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTT
CCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAG
CTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACA
TGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTT
TCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGC
GAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCT
CTCCTGTTCCGACNCTGCCGCTTACCGGATACCTGTCCNCCTTTCTCCTTCNGGAAGCGT
GNCGCTTTCTCATNNCTCACNCTGTAGGTATCTCAGTTCGGTGTAAGTCGTTCGCTNNAA
NNTGGGATGTGTGCNCAAACCCCCNGTTNANCCCGANCGCTNNCCNNNNNNGNNACTATT
AGNANNANTNNAACGGGAANACACANNNATTGGNCTGNNACAGCCANTTGGTAAANGAAN
ANNAN
Quality >S03036-01_B12.phd
5 3 3 5 3 2 3 4 4 6 12 17 8 7 7 7 8
5 3 5 5 9 7 5 6 5 5 8 31 32 14 28 37 18
43 32 23 25 52 21 17 26 14 21 40 45 42 48 28 43 51
50 27 24 32 29 25 41 44 45 49 49 52 52 52 52 51 49
43 43 50 42 49 42 42 52 52 52 51 42 36 52 50 52 52
53 39 50 54 41 54 57 51 51 57 44 50 54 42 42 59 59
57 57 59 57 59 59 57 57 57 59 57 53 57 57 59 59 59
57 57 57 57 57 57 57 54 59 54 50 46 43 51 54 59 57
53 49 49 49 54 57 59 59 59 59 59 53 53 57 57 57 59
54 57 57 57 57 59 57 57 59 59 59 57 57 57 57 57 57
57 57 57 50 51 49 51 51 57 59 54 54 59 59 59 59 59
57 57 57 59 53 46 53 59 59 57 59 59 57 57 54 54 50
52 57 57 59 59 59 59 59 59 59 59 57 57 59 59 59 57
53 53 59 59 57 57 57 59 57 57 59 59 59 59 59 59 59
57 51 50 57 57 57 57 54 54 49 57 57 57 51 51 57 59
57 52 57 59 59 57 54 57 57 59 59 57 57 53 51 57 59
59 57 59 59 57 57 54 44 57 59 59 59 59 59 57 59 52
54 57 59 59 57 57 57 59 59 59 52 54 59 59 59 59 57
46 45 51 49 57 57 57 59 59 54 59 57 57 50 52 54 59
59 59 59 59 59 59 57 57 51 42 44 57 52 50 42 57 57
54 59 59 57 46 57 51 50 43 57 57 57 57 50 53 50 59
59 59 57 59 59 57 52 59 59 54 57 59 59 54 59 57 59
59 50 54 51 57 59 59 59 54 54 57 54 54 54 57 54 54
54 57 54 57 54 59 57 54 50 51 50 57 57 54 42 50 46
54 57 54 54 54 57 54 38 42 54 54 54 54 57 51 54 50
54 54 43 49 49 42 51 43 54 57 46 49 54 54 59 54 57
57 59 59 59 54 59 54 43 59 54 54 57 57 43 54 59 54
53 39 53 42 28 35 49 49 54 46 59 32 57 44 51 53 35
51 49 37 54 54 59 54 46 49 35 54 38 57 52 49 46 50
22 52 52 52 49 46 41 41 40 35 42 28 49 35 37 53 44
46 35 44 42 49 50 51 53 53 45 35 50 27 52 50 49 49
49 46 49 46 49 49 51 32 46 39 39 46 49 49 35 46 35
35 35 30 52 43 49 36 50 37 49 49 21 20 20 49 50 49
43 26 36 49 35 43 35 41 35 35 37 33 26 22 16 28 35
52 38 42 43 35 46 52 35 13 13 25 49 35 31 33 42 12
42 31 52 49 28 32 41 39 31 37 39 41 35 41 34 41 43
52 34 31 46 41 32 31 38 49 37 36 28 41 37 33 15 27
52 35 29 36 46 40 32 41 41 30 35 35 37 40 41 32 10
28 35 23 39 36 34 35 26 20 36 28 32 34 34 28 32 19
19 26 36 31 33 15 12 8 18 14 6 20 26 35 28 26 31
27 32 31 26 14 19 25 28 35 18 15 20 22 24 30 20 9
20 6 10 20 16 10 14 16 13 13 11 12 24 15 5 9 13
19 13 15 12 12 20 34 5 9 33 31 16 12 26 28 18 21
13 12 5 7 15 27 27 31 13 6 9 9 12 9 16 20 30
18 21 18 21 17 16 20 15 26 26 18 9 18 19 16 15 12
9 23 22 23 18 17 21 12 9 11 10 5 7 9 11 6 7
16 14 29 16 9 16 21 12 13 16 9 9 6 9 9 13 10
15 13 13 17 11 6 12 13 13 7 12 6 9 12 11 11 11
6 9 9 12 8 5 7 18 11 6 7 7 6 6 7 9 6
6 21 14 11 16 12 9 11 10 7 9 6 7 9 6 9 7
6 15 13 8 11 15 16 8 10 7 22 9 16 10 11 6 6
6 11 16 14 15 8 6 9 12 13 7 5 10 9 12 10 14
14 12 6 9 15 21 18 21 21 15 11 6 13 9 9 5 9
7 6 9 6