S03036-01_O16
Seqid S03036-01_O16
Sequence >S03036-01_O16.phd
TNNNNGGNANANNNNNNANGGNGANTGGCGGCNNATCGGCCGATTGGATTAAAAATAAAA
AAAAAAAAAAAANNNNNNNAAAAAAANAAAANGAGAANNAAAAAGAAAAAGGTACCGGCC
ATAAGGGCCAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCA
TAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGA
AGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTG
CGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGC
CAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGAC
TCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATA
CGGTTATCCACANAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCNGCAA
AAGGCCAGGAACCGTAAAAAGNNCGCGTTGCTGGCTTTTTNCCAAGTCCCCGCCCCCCTG
AAGAGGATATGAAAANNNNNCCTCAATCAAAGGAGGGTAAAAACAGGAAGAGAGAGTNAA
GGAANCAGGNTTTGTGCTTTGTAATTGGTTNATAAAATGTGGAGACCACCCCCGCCACCC
CCAGAAGGAGAAGCAGCAGTACAAGTGTTATAGTTATGACGTAATGGTAAGGATAAGGAT
GGTAATGAATTAAGGTGGTAAAAAAAACGAATANAAANAAAAATAGAGATCAACAACACT
AACAATGTAAAGGAGGATNGAAGNANGAAAAAANG
Quality >S03036-01_O16.phd
8 5 3 2 5 15 18 7 8 7 10 6 5 5 5 5 5
9 6 16 12 7 21 19 6 17 26 9 9 10 12 8 5 7
12 28 27 29 25 16 22 25 21 19 29 25 14 10 14 45 18
14 11 11 9 9 18 10 15 19 26 30 24 26 19 29 26 25
18 18 15 9 6 6 6 3 4 4 5 20 27 18 17 10 9
9 6 9 16 10 12 6 12 10 10 11 10 7 6 9 12 12
12 12 9 17 14 13 12 19 11 16 23 15 31 22 14 11 15
14 9 22 22 28 42 39 22 35 36 15 14 22 24 38 35 22
19 24 22 35 35 35 32 29 22 21 13 19 28 31 29 20 35
35 30 35 43 47 42 35 19 24 28 26 37 28 24 23 37 46
35 41 47 17 23 30 45 33 42 19 32 28 39 42 35 41 46
42 35 42 28 19 31 13 18 10 23 42 53 42 42 33 27 33
33 23 31 42 27 19 23 23 32 24 32 34 35 44 53 53 44
26 40 32 24 38 40 34 33 42 41 40 24 50 28 50 53 34
34 37 53 37 40 28 37 41 53 37 23 24 38 22 60 53 40
31 40 37 28 50 53 53 40 24 40 50 40 31 41 50 40 40
23 19 14 30 41 37 42 40 40 40 31 31 33 25 34 23 47
53 40 28 40 42 42 24 29 42 40 47 38 34 40 44 42 42
24 28 40 60 57 42 35 33 53 60 53 53 53 50 53 41 47
42 40 26 40 53 37 50 40 40 50 32 41 19 18 31 53 53
33 42 35 35 38 27 23 45 45 45 42 25 38 38 35 42 35
38 37 45 37 53 53 41 35 41 31 42 42 60 41 33 18 14
30 53 53 45 42 42 42 53 47 47 42 42 42 42 42 42 53
57 42 20 27 35 35 35 53 45 45 39 30 26 45 45 47 39
25 32 34 41 53 42 37 39 37 41 37 42 42 47 22 29 37
32 39 24 35 30 42 60 43 47 60 47 47 47 47 46 35 27
44 47 52 42 35 15 13 35 25 19 21 26 17 21 31 35 28
11 19 22 27 18 25 29 31 18 35 35 44 50 15 38 42 22
22 19 22 31 28 34 38 23 31 27 38 42 40 16 24 10 6
22 30 27 27 27 30 54 43 19 25 21 22 27 23 10 27 31
32 32 32 32 30 16 27 32 27 21 28 28 24 28 30 27 35
31 35 28 27 28 27 13 9 6 27 16 32 38 35 19 18 21
16 19 18 22 30 27 21 30 26 23 21 14 20 30 16 22 11
6 6 9 12 20 27 30 17 16 19 18 20 16 9 13 27 28
17 14 7 9 12 10 12 12 10 14 10 20 20 15 19 30 19
19 14 15 9 10 12 12 15 22 23 15 9 8 11 10 9 13
16 14 8 6 6 7 6 6 8 19 18 13 11 30 9 8 10
9 12 14 8 11 14 11 14 15 21 13 19 16 15 13 11 11
11 14 11 10 16 13 22 26 13 11 10 7 12 18 17 12 12
9 7 9 11 14 12 6 11 15 14 14 15 13 15 10 15 9
12 11 13 8 8 13 19 13 9 9 7 11 10 30 12 13 15
17 13 9 11 12 11 11 13 10 10 10 13 13 15 20 17 14
11 10 10 13 16 18 12 11 11 12 14 14 15 19 17 13 10
11 11 11 11 15 12 12 11 11 14 14 16 17 17 14 14 16
11 9 11 11 9 11 18 15 11 14 13 8 16 14 14 10 12
18 20 20 19 10 10 9 10 9 11 11 10 11 15 8 8 9
11 28 16 12 9 18 13 11 14 24 15 10 11 11 12 17 19
20 17 11 11 11 12 14 10 10 11 14 10 9 11 7 14 14
11 7 9 26 11 32 10 11 11 12 14 14 11 15 11 11 12
12 11 11 11 13 9 8 15 17 12 11 20 18 14 16 17 27
19 15 11 10 14 18 16 12 6 9 11 9 11 7 9 6 9
10 11 11 11 9 10 6 8