S03036-01_O18
Seqid S03036-01_O18
Sequence >S03036-01_O18.phd
NNNNNNNNTNNTTNNNNGNNNNNCCANANANGGCGNATTGGCGGCCAAATCGGCCGAATT
TGTGATGTATATATACACATATATGTATATTATACTCTAGAAAATATTTTTACCGTTCTA
AATTTCTTTGTCCTTTGTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAGTACCGGCCATAAGGGCCAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTG
GCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACAC
AACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTC
ACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTG
CATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCT
TCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCAC
TCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCNGGAAANGACCATGTG
AACAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCCCCGTTTGCTGGAGTTATAC
CATAGGCTCCGCNCCCTTAAGNAGGATTTCAAAAATCNAGGCTCAAATCAGAGTGGCGAA
CACCCCGNGACAAAAAAAGTACNNGAGTTTCCCCNTGGAAGATCACANAANANGAAACAG
GTNAAGAACNAGCGAATTANGAAAACAGGNCACCGTTANNGCTACAGAGAGNNANANGAT
TCTGCAAGGGCACGANGAGAGNAAANANNNNNGGAANNGATNNTANCNGANAGGNGNNNN
Quality >S03036-01_O18.phd
4 3 3 4 5 3 4 6 12 5 7 12 10 7 7 7 5
8 5 5 5 5 6 9 9 8 5 8 5 9 6 22 16 9
21 6 26 9 16 21 13 16 40 21 14 19 13 13 29 29 33
41 28 37 30 32 30 10 34 49 39 30 38 42 30 21 43 41
41 35 43 49 49 49 49 36 42 38 50 49 54 54 54 50 50
49 49 46 50 41 41 54 54 54 54 50 49 44 44 46 44 54
50 54 43 59 46 54 50 42 44 42 50 60 49 42 47 49 47
60 41 41 49 60 54 60 54 60 49 60 49 60 49 50 63 43
47 51 44 41 22 42 47 54 60 54 54 60 60 60 60 60 60
60 43 63 51 60 43 43 43 43 43 46 60 60 49 46 43 43
43 43 43 43 43 41 43 43 43 43 43 41 44 43 22 11 19
35 35 29 35 44 44 35 27 20 29 28 44 54 46 34 44 44
42 36 39 42 39 42 32 28 28 35 44 42 43 35 42 39 42
26 26 42 31 44 31 50 43 33 43 49 49 42 42 42 46 39
35 46 33 32 42 35 43 43 50 50 27 25 42 42 29 42 42
42 54 43 54 39 43 42 50 43 46 33 29 39 39 54 39 42
50 54 54 42 54 52 50 43 43 50 50 37 29 34 42 50 35
43 42 43 50 54 54 50 27 43 38 46 51 49 43 43 37 54
43 35 40 35 49 49 49 46 45 46 30 32 26 35 54 49 35
35 35 42 37 54 49 49 49 36 43 35 54 53 40 43 35 38
29 46 37 49 37 31 40 43 43 35 54 36 37 46 32 35 35
37 35 46 30 49 43 49 42 35 35 30 35 35 32 40 39 35
46 46 37 43 46 43 41 31 35 40 46 34 27 29 35 49 51
46 35 40 28 37 49 46 49 49 43 49 49 46 29 35 41 37
37 37 31 27 39 46 37 21 25 35 46 43 46 35 43 36 43
49 32 35 46 49 28 49 37 42 42 35 35 42 35 35 49 41
52 52 52 35 35 35 23 36 26 42 42 37 35 35 46 46 41
42 31 35 26 31 35 37 36 42 27 46 30 41 35 43 49 35
41 33 37 38 42 30 46 35 37 31 31 46 32 28 35 49 41
43 35 43 35 35 31 42 43 33 28 32 37 27 46 49 28 37
41 36 36 26 40 37 21 46 46 30 20 21 15 12 35 28 34
32 30 30 32 32 28 26 23 30 41 32 23 17 25 21 30 42
42 34 24 12 32 46 30 14 17 13 14 26 31 31 19 32 34
30 22 26 13 26 21 17 27 26 18 32 22 26 32 34 19 26
20 16 31 28 14 17 6 10 23 26 34 28 7 8 17 9 11
10 20 15 14 14 22 9 15 13 32 36 19 16 13 17 16 20
9 18 25 41 34 33 24 18 14 20 9 26 26 23 25 28 25
12 13 12 20 34 27 28 14 17 23 19 8 11 12 9 12 18
11 13 9 9 9 16 16 16 15 21 14 19 13 13 16 16 11
13 14 12 11 13 9 9 10 10 7 14 21 13 14 8 10 11
10 6 18 14 13 10 13 12 9 10 17 14 24 20 11 8 10
7 15 11 10 12 28 14 24 10 17 11 10 17 10 16 12 19
10 14 11 11 26 28 10 8 10 16 17 19 10 7 17 32 15
14 17 13 18 20 20 9 10 8 8 11 6 6 15 10 13 18
21 27 20 28 19 17 7 12 19 14 12 29 11 11 19 8 11
8 10 6 9 11 7 9 7 12 19 20 11 14 13 14 10 12
7 10 14 11 22 19 10 7 19 17 15 16 9 11 10 14 19
7 9 12 11 16 14 9 10 10 19 6 13 11 8 12 13 8
16 17 7 7 10 10 8 8 8 11 20 16 17 13 14 7 6
9 6 10 6 10 11 13 10 10 12 10 14 14 16 14 14 16
11 10 10 13 11 7 12 12 17 15 15 7 8 9 11 6 9
6 6 6 6 7 15 14 9 10 5 5 10 8 10 6 6 11
12 7 15 6 10 12 6 9 10 19 5 10 5 5 6 6