S03036-01_O20
Seqid S03036-01_O20
Sequence >S03036-01_O20.phd
NNNNNNNNNNNNNNNNGGGNNNNNNNNANANGGCNNNNGGCGGCCAATCGGCCGAATTGA
TAGTCTTAAGTAATCATTCAAAATGCCAAAGAAGAGAGCTTCCAACGGTAGAAACAAGAA
AGGTAGAGGTCACGTCAAACCAGTCAGATGTGTCAACTGTTCCAAGTCTATTCCAAAGGA
TAAGGCTATCAAGAGAATGGCTATCAGAAACATTGTTGAAGCCGCTGCCGTCAGAGATTT
GTCCGAAGCTTCTGTCTACCCTGAATACGCTTTGCCAAAGACTTACAACAAGTTACACTA
CTGTGTTTCTTGTGCTATTCACGCCAGAATTGTCAGAGTCAGATCCAGAGAAGACAGAAA
GAACAGAGCTCCACCTCANAGACCAAGATTCAACAGAGAAAACAAGGTTTCCCCTGCTGA
TGCCGCCAAGAAGGCTTTANAANTTGATTAANATAGGTGAAAATGGTTAAAATTTTCTGC
TAGTTCTNATCGAGAAGNAGAAAGCAANAAAAAAAATNAAAACTNACATACNGNCNGCCC
GGCCATAAGGGGNAAGGGGGNAGNNTAAAAAGGGGTGAGGCAGTGGGNGGGNGNAGTGAG
GGGNGGACCGTTTTNNACGCTGAAAAGGGTGATGAGGGGNAGNGACGNAAGAGNGGAGAG
TACACCAANGCTGCGTTCGTGGGGGGCTGAAATAGGTGCAAAGANGAGGCANATAGGCCC
NGGGACANGGGAAGCNNGGTGGGTCGGNGNGNCGCGCGGCCGGTTGTNTTTGGTAAAAAC
GAATGNNGGTAGCNGGNNAGTTAGCATGGTCGTNNNCGGTGGGCGGNCGAAAGACAGGNC
TGATNCCGGANNNCCAGCGTGAAGAGCCGGAAANNN
Quality >S03036-01_O20.phd
4 4 3 3 2 3 5 4 4 3 5 5 5 5 5 5 24
25 16 7 7 5 6 7 3 3 5 10 7 10 5 18 18 9
7 6 3 5 24 14 10 42 22 12 8 13 10 13 21 19 27
28 26 29 21 14 30 32 29 10 26 23 21 26 30 28 31 18
16 22 28 22 28 34 44 35 31 43 28 28 26 42 42 38 42
38 30 35 42 54 42 50 49 43 49 39 50 42 44 60 47 47
33 12 31 47 42 40 42 44 42 46 44 34 60 39 42 60 35
27 33 35 52 30 29 19 32 32 48 47 60 41 48 43 48 57
41 47 52 52 52 42 42 48 57 47 44 52 57 57 60 57 57
52 46 40 48 48 52 57 57 60 48 35 53 53 63 57 57 60
52 57 57 52 52 60 57 63 48 48 52 60 60 52 53 57 58
57 58 57 57 60 63 63 58 58 57 52 58 48 52 52 57 57
63 60 48 58 48 48 60 47 48 48 60 48 48 57 52 52 52
57 63 42 52 58 60 48 53 48 43 48 35 35 48 20 33 32
35 40 40 30 35 32 28 43 44 44 60 60 43 43 48 57 47
57 57 57 57 52 57 52 52 52 60 60 41 52 48 48 60 60
60 52 57 48 42 53 53 40 52 41 60 63 42 60 47 52 52
46 52 57 57 48 46 60 35 52 52 40 52 52 57 46 57 52
52 57 60 47 48 48 24 57 37 52 44 37 48 41 19 47 42
48 53 42 52 58 52 42 58 43 35 52 32 35 53 23 52 42
21 30 53 12 48 63 24 32 24 8 34 48 41 52 22 47 41
20 18 40 40 48 48 42 41 37 48 21 48 60 47 57 20 52
52 46 24 11 5 12 27 42 32 47 17 20 16 45 36 28 16
9 23 52 53 39 48 41 38 32 47 46 45 20 41 45 48 12
23 17 12 16 29 21 31 44 23 39 35 14 14 17 32 45 22
45 42 9 15 11 16 35 24 42 20 32 35 18 9 5 9 18
6 11 16 39 41 44 45 37 13 7 24 41 22 14 28 25 12
13 13 9 9 8 9 10 8 12 14 46 28 10 19 13 9 10
22 14 11 19 11 13 9 9 11 9 11 6 10 10 9 10 12
10 12 9 9 6 9 10 11 10 13 11 9 11 10 6 11 19
11 33 27 16 26 11 11 6 13 14 24 13 9 9 6 13 11
12 11 10 9 7 9 6 10 6 10 9 9 21 11 12 12 11
16 11 10 12 23 41 11 9 6 8 11 13 16 13 13 9 6
13 9 6 7 11 10 11 13 10 16 13 17 27 16 10 10 10
10 9 9 9 18 13 20 11 9 7 10 12 16 6 22 6 9
11 14 10 12 15 14 15 8 7 19 9 10 11 17 13 11 14
14 11 7 7 11 13 10 9 9 9 11 9 16 12 10 34 18
10 13 10 8 13 16 13 10 11 9 7 16 11 7 9 9 11
9 6 15 19 16 15 15 7 10 10 11 11 19 14 11 14 8
10 9 9 25 9 6 9 9 9 10 10 10 9 9 11 15 10
19 9 19 10 12 14 11 9 11 9 10 8 9 12 11 13 13
15 11 10 13 9 11 8 7 9 14 8 12 11 9 6 11 8
9 12 11 9 15 11 7 9 9 11 12 10 9 7 20 12 10
9 11 8 9 7 6 11 8 9 11 10 11 10 11 11 8 6
11 6 12 6 8 11 8 10 9 11 11 11 15 15 9 9 10
10 9 6 11 10 11 12 10 9 11 14 14 20 10 9 9 11
9 11 9 6 7 10 14 11 10 11 10 6 8 10 6 6 11
11 9 9 13 9 9 9 10 11 10 11 8 10 9 6 6 6
8 11 13 10 10 10 10 12 10 14 5 9 10 11 8 11 11
11 11 10 14 10 6 8 16 16 9 8 6 8 11 10 11 11
5 6 5 8 11 8 11 11 8 8 12 11 10 9 8 10 13
8 9 10 10 10 10 5 6 5