S03036-01_B13
Seqid S03036-01_B13
Sequence >S03036-01_B13.phd
NNNNNNNNNNNTTTTCNNNCCNANNNANNNNNNGATTGGCGGNNNNTCGGCCGAATTGAT
TGAAATATTTGCAAAGACGCCATTCAAGAATCAAGCCTGTTGAAAATAAAGGTACAAAAT
TAAATCCGCTAATTATTTTTTTTCGTGTTCGACTAAAGTTATCGAAAAATTGAAAATATA
CAAGGACTAGCTATACTATCAATACGCAAAGAAAATACAAAATAAACGCACATTCGTTCT
ATAGGCGATAACTTGGCAGAATTTTTTAGTATAAAATGGATCTATTCAAAAGAAAAGTTA
AAGAATGGGTATACTCCCTCAGCACTGACGACCATTATGCAGAGTATAACCCCGATGAAA
CGCCTACTTTTAACATGGGTAAACGTTTAAACAGCAACAATGGTCAGGTAAATCCCTCTC
AAATGCATTTGAATAGTGTAGATGAGGAAATGAGCATGGGATTTCAAAATGGCGTGCCAT
CTAATGAAGACATAAATATTGATGAATTTACGTCCACGGAGTCAAACGANGGTGTTTCTG
AAAAACTANTAGCTTGGAGANCATTGAGNNTTGGATGGTGAACATNAAAAAACAANNAGN
GNACTCNGGGCGGAGCGGNNGGGGGGGGGGGATNNCTTGTNAAGATGATAAGTAATAGAC
TTNCGGACCGANNGGATCATTAGAAAATGTTAAGAGAGNAAGGACAGTTTAATNTGAACA
ANNTCNGGCTTGTCTGATGCANNACNACAAGTGATNANANANNNGNATGGNNGATTAATA
GNGGGAGAAGGGGAGGAGTCTAGCGAACGTAGAANANAGANNCANNNANTAGTACATCTA
AAANNGTGGAGATGGGGGGCGAACATGNNAANGGNNTAAGTTATGNGTNAATNNNNNN
Quality >S03036-01_B13.phd
5 5 3 2 5 5 3 3 3 2 4 8 9 8 8 9 7
7 7 9 12 7 8 5 3 7 12 7 5 5 7 7 6 22
19 16 15 30 18 13 21 14 6 7 5 6 25 25 31 28 28
30 27 19 14 36 29 21 10 21 35 30 23 22 22 18 26 31
38 31 25 21 30 36 28 21 20 11 15 17 16 21 28 28 20
12 14 24 33 31 31 33 18 30 43 50 35 31 42 24 26 33
27 22 24 35 27 22 18 23 36 31 18 20 26 22 22 22 26
28 26 21 22 22 26 35 42 44 42 44 35 42 47 50 60 45
49 60 49 60 60 60 47 47 35 44 57 57 44 46 44 46 30
46 52 43 41 46 60 52 57 57 52 52 46 40 47 60 46 52
44 47 44 60 57 57 60 57 60 52 52 47 52 60 57 48 42
54 52 60 57 52 60 57 57 44 44 43 41 41 47 47 43 60
57 47 52 47 45 43 57 52 60 48 52 44 57 48 23 42 60
35 40 41 35 42 47 41 57 24 60 46 47 34 40 41 35 35
35 25 28 27 20 35 57 19 42 46 35 47 42 47 60 57 57
60 46 46 60 52 52 46 63 63 63 53 40 42 46 52 47 42
28 60 57 57 44 57 60 52 23 60 47 60 52 60 52 31 52
60 57 52 52 52 48 48 52 41 60 47 46 19 24 35 29 34
57 45 42 35 52 42 39 34 23 40 43 43 43 44 35 47 43
32 27 46 52 52 35 60 57 22 40 35 60 46 46 47 52 47
27 47 52 60 40 47 34 33 40 40 47 35 41 37 35 35 60
37 15 40 40 46 29 40 32 40 46 60 44 60 52 46 47 47
44 60 60 63 43 46 60 49 60 42 40 43 46 43 33 41 19
33 35 60 47 60 43 40 39 49 47 43 43 60 47 50 44 63
44 47 63 60 47 47 60 43 47 47 40 40 24 35 43 44 60
47 42 47 43 43 41 43 25 23 33 30 25 42 13 50 60 47
42 49 44 16 63 31 49 60 27 42 60 27 35 29 42 37 33
23 16 17 21 25 27 24 33 16 17 20 33 27 24 19 36 38
27 20 20 42 38 23 24 28 27 43 22 27 29 25 21 22 22
15 15 17 22 24 24 27 42 19 35 20 22 24 27 22 9 11
24 47 35 21 29 18 29 28 19 23 21 42 24 15 42 24 13
12 12 6 10 14 9 22 12 12 12 16 13 18 35 28 22 10
9 9 9 9 7 12 15 13 24 31 39 31 20 19 13 13 7
16 10 23 9 9 10 9 6 7 26 16 21 17 9 8 8 9
13 22 18 28 9 12 13 7 10 9 9 11 11 11 8 10 9
6 6 9 9 6 9 7 9 10 19 10 7 12 12 10 9 19
9 10 9 9 9 10 6 6 8 24 9 11 11 18 17 15 9
10 10 10 11 6 6 10 10 11 8 9 6 9 27 9 18 11
9 20 17 14 9 11 8 18 9 8 11 10 8 11 14 10 6
10 11 11 11 12 14 14 8 6 6 9 8 16 10 12 10 10
11 9 9 9 9 11 22 12 8 14 13 15 9 10 9 8 11
15 7 12 12 28 23 18 10 12 11 10 11 10 10 10 9 6
9 8 14 10 11 21 13 6 7 9 9 6 9 9 9 9 11
12 9 14 11 16 9 10 9 9 9 6 6 9 10 7 9 9
9 12 9 11 10 10 8 7 9 6 9 6 8 6 6 6 12
7 10 9 9 9 6 6 15 14 10 12 10 17 8 8 10 7
14 9 9 9 9 9 10 9 9 8 11 10 9 9 11 10 11
10 10 13 9 9 10 12 14 11 11 11 12 11 11 11 7 11
6 18 9 12 6 6 11 11 7 6 6 14 6 9 11 9 11
9 9 10 9 11 14 10 9 10 10 6 6 16 10 10 8 8
14 10 8 14 10 14 10 11 9 11 9 9 11 9 11 8 14
6 7 9 14 6 22 14 6 6 11 9 8 9 9 9 8 12
10 7 10 10 7 9 11 11 7 6 7 6 6 6