S03036-01_P01
Seqid S03036-01_P01
Sequence >S03036-01_P01.phd
NNTTNTTTTTTTNNNAANNAAAATAAANGGGGNGAGTGGGCGCCAATCGTNCGATNAGAN
TGCNACTGACTCCACNNAAGCTTGGNCTTTTTGCTTTNTGATCTGGNGGNAATTTGGTTC
CGTTANAANGGCTTGCCTCAACCAANGNGATTACTCTCAAATTTGATTNAACACTTCGGA
ACATCAAGGCCGGNNCCATCGACGCGACGTTGATTCCAAGGTTTTNTATTCNTGATTTTA
NTGCATTGGTAAATGCAAGAGTGACAACTATTGGGAGAAACTTTTTCGTGGCTATGGGGT
NTTCANNC
Quality >S03036-01_P01.phd
6 5 10 8 6 10 15 10 25 12 9 8 5 7 6 12 8
7 6 10 8 10 12 9 9 9 10 6 12 14 27 17 5 9
8 11 12 32 21 9 8 9 9 11 9 10 25 20 19 10 7
10 10 9 9 6 8 11 18 6 9 20 10 7 10 11 12 9
13 9 11 16 20 20 11 6 6 9 14 11 24 19 29 11 10
6 29 11 9 11 9 9 9 8 9 13 10 7 18 19 12 10
17 9 9 9 6 9 10 6 9 11 19 24 10 14 32 30 31
27 31 25 37 26 11 7 11 9 6 11 9 8 9 10 9 16
14 12 53 53 19 14 22 53 37 6 11 6 9 22 22 18 28
53 10 33 9 9 10 12 18 26 26 23 18 9 11 14 7 9
9 14 8 9 18 20 14 22 15 10 11 10 11 19 13 9 9
24 20 13 20 9 9 6 6 8 17 13 32 26 10 10 11 27
19 12 26 22 46 13 14 13 12 11 11 9 22 9 17 14 32
11 19 16 23 7 8 14 16 17 9 6 16 27 20 20 11 16
29 9 6 10 8 9 9 8 14 16 9 9 9 9 11 10 9
23 27 9 11 14 17 11 8 18 10 13 13 21 13 17 21 23
16 10 10 10 12 11 14 16 10 10 18 22 19 11 8 11 10
14 8 9 13 21 16 10 10 12 17 12 6 14 11 8 14 7
6 15