S03036-01_P02
Seqid S03036-01_P02
Sequence >S03036-01_P02.phd
NNNNNNNNNNNNNNNNTNCGGANCTNNNNNNNGGCGATTGGCGGCCANATCGGCCGAATT
GACTGCTTGTGGTGGGAAAAAGGACGTCGTTATTACCGAAACTGGTTGGCCATCTAAGGG
TGATACTTACGGCGAAGCTATCCCATCTAAAGCAAACCAAGAAGCCGCCATTTCTTCTAT
CAAAAGCTCCTGCGGCTCTTCAGCTTACTTATTCACCGCCTTCAATGATCTATGGAAAGA
TGATGGGCAATACGGTGTTGAAAAATACTGGGGTATTCTATCAAGTGATTAAACCACTGA
AACTTCATTTACTTTATGATCATTCTTTTTCCCTTTTTCTTAAAAAGCAGCCAAATATGG
GGGAAATAAGCCCTTTCCCATATTTGCTCTCCTATTCTTATCACGTTATTGTTTACTTAT
GTGTTTTGTGTAAAGTATATATTCTATACTCATTTGTGAAAGATTTTNCAATTTGTCTTC
NGAANAAAGAAAAGGGAAAAAAAAAAATTTNATNNAATAAAAATAAAAAAAAAAATAAAA
AAAAAAAAAGTNCNCNCTAAGGGGCGACGGNNGAAAAGGAAAAGAACNNCTTNCNCNTTT
CCCGCGACNNGGNGGGAGNAGGCGGNGNANAATTTTTTGTTTAAAATTAAACNGGCNCAA
ACCCANAAGAAAGTGGAAACCNNGAAAGGAAAAAGAAAAGACANANNCAANCACAGAGCG
GAGGGGGAGTNGGATGGATAGTNTAGATATAAAAGAAAGANNGATNACNATNTANAGACC
TAGGGATACGGAATAANAANNN
Quality >S03036-01_P02.phd
5 2 3 3 3 4 4 4 5 3 2 2 4 6 5 3 8
6 8 10 12 9 5 10 9 6 6 5 3 3 3 3 12 12
13 18 26 23 31 33 15 14 29 19 9 18 9 7 11 41 25
32 28 35 44 36 26 9 21 33 31 11 20 33 40 35 41 41
51 40 32 26 26 39 32 38 35 49 41 31 31 32 46 20 18
32 35 37 27 35 42 37 31 28 43 43 37 35 30 35 21 42
37 47 31 29 31 38 34 25 30 26 39 34 38 35 42 35 43
39 35 49 35 27 42 44 44 44 43 44 35 50 50 44 44 50
38 54 50 42 54 54 54 50 44 49 51 45 39 50 50 50 54
54 53 53 50 50 50 63 63 63 63 49 50 63 58 52 50 50
63 63 58 57 60 58 49 50 49 60 50 49 54 51 63 58 49
63 58 63 63 63 63 63 58 51 58 50 63 63 57 50 63 51
51 50 60 44 60 50 60 47 63 47 47 51 51 60 63 58 60
51 50 47 49 60 58 57 50 59 50 49 49 50 63 47 43 41
44 44 32 47 35 21 40 63 52 60 60 60 60 57 52 57 52
57 57 60 43 57 52 52 60 57 57 57 60 52 60 58 58 58
63 60 52 36 57 57 52 58 57 52 57 63 57 51 63 44 28
58 60 58 60 46 43 44 58 47 44 63 49 43 43 46 43 41
47 49 60 42 40 49 60 63 43 47 47 60 51 35 47 47 47
60 47 60 46 43 43 43 43 41 23 43 60 49 49 47 46 60
43 33 41 33 33 41 33 44 40 35 43 42 35 44 38 23 33
47 60 60 51 58 47 17 17 41 42 47 60 49 60 51 60 60
58 63 44 41 43 40 47 42 47 46 46 47 60 49 60 43 39
43 35 40 47 60 49 42 49 60 44 50 44 60 47 49 60 49
47 63 50 42 33 33 47 47 49 46 39 42 60 40 44 35 43
43 41 44 24 44 39 39 49 41 33 22 42 35 47 47 42 40
40 47 42 47 35 44 44 50 39 44 16 16 37 40 35 32 21
21 21 17 35 10 24 19 10 7 19 8 15 14 18 16 14 19
33 22 18 15 5 10 9 10 6 11 12 9 14 9 9 9 9
11 11 9 12 14 10 9 19 11 12 10 11 13 12 14 9 9
6 8 13 7 6 9 9 9 8 9 9 10 18 9 11 11 9
12 31 13 42 41 46 18 47 8 42 44 52 33 18 13 12 10
20 11 22 14 15 11 10 7 8 6 9 7 10 11 22 11 11
10 11 11 14 12 14 9 10 11 6 6 9 9 9 14 19 14
19 11 12 13 16 11 11 11 11 6 6 9 9 9 6 8 6
11 7 13 9 9 10 9 10 10 12 11 11 9 6 7 13 16
5 10 13 18 9 18 6 9 13 10 10 11 11 7 9 6 10
5 12 9 11 13 16 16 12 9 18 30 53 12 11 20 16 50
10 14 9 11 10 9 6 10 10 10 7 9 23 23 10 11 11
11 19 7 18 17 9 9 16 11 19 10 9 14 11 9 14 13
9 6 6 13 11 12 9 10 11 10 13 9 18 9 9 19 16
13 10 8 9 14 9 6 9 6 6 9 10 9 6 14 9 14
8 8 9 11 11 9 19 10 19 27 12 14 13 10 8 9 6
16 10 10 9 9 10 11 10 9 8 9 6 9 10 9 11 9
13 9 10 11 14 12 9 11 11 23 13 9 6 6 9 12 9
6 9 10 6 12 9 6 8 9 6 11 10 14 11 10 12 8
16 8 9 9 12 8 10 15 11 14 10 8 9 11 6 8 11
5 5 5