S03036-01_P03
Seqid S03036-01_P03
Sequence >S03036-01_P03.phd
NNNNNNNNNNNNNNNNNNNNNNTNNNTNGNGGCGATTGGCGGCCAATCGGCCGAATTGAG
ATACTGTAAATAGAACACACGTTTTTTAATTTATTTTTTTTTTTTTTACATATCTAAATT
TAATATAAATCAAAAAGCCCAAGCCTCAAACAAGAGTCTTATCACTCCATTTATAACATA
ACACTTCGAAATCTCTAAGCTCGCTTATAGTTGACAATGACCATATTTTCTAGGTTCTCA
TATTTTGATAGTCTATTCTCCTTTAAAAAGCAAGAGCCTTCCCCCATTGAAATAATCTAT
TGCAATGAAAACAATGGTTTCATAAACATAAAATCCTTAGAAAGCCCCACTGACGATAGC
ATGGAGGCGGACATTTCAGATAGAGAAATGGCTACAATCCTGACTAGAAACAGAAACAAT
TTGGGTAAGGTTGCCATTGATAAGAAAGGCGTTAATAATCATTGCATAGATTTGAATGAG
CTGAAAAAGGGGCTTGTCGCCAATGAACACAAATTGGATAACGATAACTCAACACGGCAC
CAGAACACATATTCACCAGAGGATTCCGTGGAANTTGATAGGTTCGATGANAAACAAAGC
AGAATACTAAAGTGTAGCACTAGAAGGAGCTACTTGAGATACAAGAAATAAGACAAATGN
AGCTNCTTTCATATATATCCTGANATAATCTTTGTGCCTCCATAAATATATAGNTCCAAA
AGGTGATATCNTATACTAATTANTATNTTTGANNGGAAAAANGAAANAGAGGGAAGGAGG
CACAGAAGAAAAAAAAGGTCCNGGGCATAGGGGCCAGTTGAGTATTTTATAGTGTCACCT
AAAAAACTTGGGAAAACCAAANN
Quality >S03036-01_P03.phd
2 2 3 2 4 3 3 2 2 4 3 3 2 2 6 6 4
3 3 5 5 5 8 5 5 3 9 6 11 6 25 30 10 27
22 12 29 34 17 16 44 24 16 16 19 26 45 36 43 25 36
43 29 28 15 26 48 41 31 32 17 18 20 32 51 52 35 41
47 40 37 37 51 44 52 32 42 38 43 50 49 49 49 49 32
36 27 20 13 30 46 32 49 43 51 51 49 49 46 46 49 52
49 46 43 46 42 32 43 26 49 42 54 46 42 50 59 54 54
49 50 46 49 46 54 46 46 49 49 40 43 50 49 49 51 49
50 50 53 43 31 45 49 49 34 20 29 39 39 51 35 42 45
43 50 37 40 43 46 51 43 43 49 39 50 42 54 50 26 49
49 57 35 46 39 54 44 36 50 42 53 44 30 50 54 57 42
44 54 57 57 39 39 39 42 39 42 57 36 54 39 39 36 39
42 51 36 35 36 39 42 49 42 38 28 27 52 42 43 36 39
60 29 54 33 60 63 63 58 44 33 44 44 63 25 54 42 24
42 28 39 39 39 60 60 51 47 35 28 44 35 44 44 35 44
35 63 44 32 44 63 28 63 63 28 63 63 63 63 31 31 31
29 29 44 21 42 57 22 46 35 57 57 53 53 20 34 57 31
28 49 49 19 28 57 31 35 29 35 31 57 44 22 26 57 31
39 22 54 57 53 21 17 57 24 42 51 21 59 19 19 20 25
30 59 57 23 21 31 26 59 59 59 22 30 50 27 54 31 20
43 53 51 30 22 57 57 54 21 35 30 32 28 30 30 46 21
25 41 31 28 32 36 39 23 26 51 22 28 57 30 21 23 38
57 57 30 28 10 26 18 13 30 37 28 35 51 51 30 41 51
30 35 30 35 10 49 30 35 49 33 36 30 22 30 35 27 32
53 53 27 20 28 43 52 53 30 13 13 19 52 53 31 53 53
17 21 52 17 23 9 16 30 26 52 23 32 53 26 21 21 21
51 19 36 49 52 21 51 14 28 27 41 22 53 23 26 52 28
32 26 27 49 32 15 17 21 29 16 26 15 19 37 25 32 51
21 20 21 11 19 19 23 30 51 51 52 32 19 33 22 9 20
20 49 34 17 29 22 19 25 13 28 21 28 34 52 19 29 28
20 51 52 22 49 21 46 30 23 24 51 28 23 40 19 13 30
30 21 23 14 49 35 20 38 19 51 21 24 17 49 14 30 35
41 30 21 31 21 27 28 18 44 20 17 30 42 17 23 36 15
50 18 9 19 14 16 16 22 35 42 20 35 6 45 31 23 28
19 31 16 34 11 31 36 17 38 14 29 17 6 10 16 28 15
17 51 24 11 9 23 18 29 36 12 19 23 14 17 40 38 14
25 22 15 15 13 30 22 27 17 24 18 18 26 10 21 12 14
17 9 15 18 16 45 15 18 13 25 16 27 24 21 32 27 33
46 32 24 20 47 8 21 14 10 22 11 20 11 7 8 12 28
10 6 9 9 16 11 18 11 19 21 21 30 17 20 14 16 8
9 10 9 6 10 15 16 11 10 14 16 46 16 19 15 14 12
20 11 9 16 9 16 19 31 49 21 23 30 24 30 21 11 7
14 11 16 14 28 26 27 18 23 15 8 18 9 13 11 12 7
11 16 31 20 31 18 12 8 44 27 10 7 9 12 10 7 12
16 12 9 10 6 7 19 17 14 16 14 12 16 7 11 16 8
14 6 9 9 12 9 14 21 15 24 24 11 20 14 10 10 13
10 11 11 17 13 11 14 23 12 39 22 14 23 11 10 16 14
14 16 7 28 31 14 41 14 19 19 18 22 46 29 14 13 19
13 24 16 20 14 25 10 13 20 26 23 14 11 12 14 10 14
12 14 17 11 18 20 11 16 46 32 32 23 14 14 41 12 37
32 17 12 23 40 11 12 14 13 14 11 6 6