S03036-01_P04
Seqid S03036-01_P04
Sequence >S03036-01_P04.phd
NNNNNNNNNNTNNNNNNGGGCNCNCNNNNNANGGNGATTGGCGGCCAAATCGGCCGAATT
GACTGAATTAAAAAGACAGACATGCATTATTGAATATTGACATTTTGAGAGTAACTTTTT
ATTATGAGTGGCATAATAAGATAATCGACGCAAGCCACAATTTATACAATAAAAAATGCT
ACCATCGCTGCTACATATGAACGAAAATAATACAACTATCGTTACGGCCTTTGCTGAACC
GTAATAAAATAAAATTCCTTGTTACATTTTTTTAGCCAGCTGCCTCAGAAAGAGGCGTTT
ACTATTTAATGGAGAAAGAAAGCAAAGAAAAATAAAAGGTATTTTCTTTACGGAAAGCCT
TCGAGCAATCCAGGAGAAAGTGGACCTTTTTTTTCCCAATGAAGAGATCATAGGAGTATG
GATTGAAAATATAATAGAACTTCGGGTAACCAGGTGTAATTTCACAGTCCATAATACAGA
GCTAACGGTTTAAGGGTAAATAGTTATCTAAGTCAAGTTTTGAAGGAACAAGTAAGAAAC
GTCGCTACTGTTTCTAAACATAAGATATACAAAAATAAATATAGCTATCTCAATGGGTGC
TGCATACAAAGTATTTGGGAAGACGGTTCAACCTCACGTATTGGCTATATCTACGTTTAT
CGCTACTGCTGCAGTGGCATCTTACTTTACCACCAAAACCAAAACCAAAAAATGAAGGCA
AGAATAGTTCTGTCCTGAGCCANNAAAAAGGCGGTNAAAGTTCCAACCNATATGCTATGG
GAAAGGGACANAANTCGNAAANGAGTGNCANGAANCCAAAAGCCAAACNAAATAGGNAAA
AAATTCTGGAATGGNGN
Quality >S03036-01_P04.phd
6 2 3 3 3 3 4 3 4 3 12 6 5 6 5 6 7
8 10 9 10 7 12 5 8 6 5 3 5 7 12 6 8 9
6 17 27 18 28 33 13 11 34 25 11 23 13 13 24 35 42
43 28 41 44 36 26 21 37 37 36 17 24 37 43 24 32 33
30 36 32 34 36 35 42 30 19 38 50 44 33 49 42 49 38
37 43 42 46 38 49 54 42 49 50 54 42 50 54 42 54 42
42 46 50 54 50 54 54 49 46 39 33 33 34 38 43 43 43
44 43 47 44 50 47 50 60 60 50 51 58 50 60 60 50 49
50 54 50 60 57 50 60 60 51 59 50 44 50 60 54 59 60
54 60 63 60 60 54 50 63 63 58 58 60 60 54 47 49 47
57 43 43 60 60 57 52 45 52 52 60 58 52 52 60 60 57
59 58 58 63 52 60 57 52 63 58 63 63 63 60 41 41 46
58 58 58 57 57 57 60 57 60 57 57 63 58 58 63 57 57
57 52 57 52 60 43 57 57 60 60 52 60 52 57 57 52 60
52 46 47 42 60 60 60 60 57 57 57 60 57 57 60 57 52
60 60 63 60 63 58 60 57 60 60 57 57 63 63 63 63 63
52 52 63 52 63 39 63 57 63 57 63 63 63 58 57 57 63
63 60 60 58 52 63 52 63 57 63 63 57 52 58 57 58 63
63 57 63 52 63 63 57 57 58 63 63 49 63 63 63 49 54
52 63 63 60 63 63 63 63 63 50 60 58 60 63 54 63 42
50 50 63 63 63 58 49 60 43 60 49 47 58 51 63 60 54
50 63 49 63 60 60 58 54 54 54 58 50 57 58 47 51 63
54 44 63 63 63 50 50 63 63 45 42 63 60 63 63 63 63
63 63 58 60 47 41 35 58 60 60 50 63 60 63 47 47 42
49 60 59 60 54 63 54 50 50 47 44 58 63 44 42 63 58
47 63 63 58 54 54 47 54 58 54 54 60 54 60 60 54 63
49 47 63 63 47 54 54 50 59 34 54 57 43 54 49 42 49
42 51 54 54 42 44 44 49 44 43 54 39 46 42 49 43 54
54 31 50 52 39 59 50 44 54 54 50 57 54 54 50 42 54
42 59 59 30 59 59 54 42 54 50 39 54 59 42 54 59 54
59 44 54 50 43 59 59 54 54 59 54 50 42 59 36 50 34
59 44 25 45 50 50 42 54 42 59 57 54 42 44 50 54 59
59 54 44 54 54 50 35 49 54 50 44 31 57 59 54 27 44
29 49 35 44 36 42 44 50 50 36 46 54 59 54 44 34 54
54 34 42 43 50 54 34 54 43 50 42 54 42 31 38 38 50
54 54 34 43 42 39 42 30 33 42 22 21 16 22 42 44 42
44 31 38 43 39 54 38 43 42 37 42 26 24 35 16 29 50
29 30 32 33 35 34 27 31 42 31 44 44 35 42 42 31 34
44 44 31 23 19 19 18 35 14 32 30 33 30 19 24 44 44
33 11 24 33 30 14 33 31 25 16 10 11 19 20 27 12 35
32 13 14 11 11 21 29 44 27 27 30 25 24 14 16 33 33
35 19 30 50 31 34 38 16 38 19 50 33 42 42 30 23 21
34 32 11 29 17 30 35 8 12 12 17 20 10 12 21 27 17
23 14 14 9 19 24 20 16 21 23 11 6 7 11 15 39 42
27 10 12 17 14 27 16 7 27 29 29 27 23 24 17 18 14
17 12 10 6 11 9 18 14 16 15 16 21 16 13 13 22 24
42 44 17 14 14 12 9 11 6 9 8 7 9 11 12 6 18
23 17 7 16 16 8 9 18 7 13 10 7 20 21 16 7 10
8 18 31 19 27 11 11 14 14 21 22 11 7 9 20 16 9
11 9 9 6 12 14 20 22 23 18 11 15 11 9 10 12 21
19 9 12 16 7 18 7