S03036-01_P05
Seqid S03036-01_P05
Sequence >S03036-01_P05.phd
NNNNNNNNNNNCNGGNNCNNNNNNNGGGNGATTGGCGGCCAAATCGGCCGAATTGAAGGA
TAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAATTAAAAATGCAATTCTCTA
CCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCCGCTTCTAACATTACCACTG
CTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTTCCTGTGAGGACCACGTTT
GTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCGTCACCGTAAATGACGTTA
TCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAGCACCAAAGAATACCACTT
CTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAAAGCCAACTGAAAAGCCAA
CCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTGGTGCCGCTGTTAAGGCTT
TGCCAGCTGCCGGTGCTTTGTTGGCTGGTGCTGCCGCTTTATTGTTGTAATTTACTCAAC
CTTTTCTTTAATATATTTTTAGAAAAATGGNTAAGTACTTTTCCGTCAATACAGCTTCCA
CAAAATCCTTTTNNTTCAATTAANANATNTCTGGNANNCNTANTCTANTCTNGNNGCAAC
ACTCATAACNAATGTTATATATATATATATAAGTATATCTCTANGTACACGCACTAACTT
ATNTATNNNAAAANNAGNNAAAAANAAANAAAANANAANNNNCGNCATAAGGNNNACTNA
NNNTCTANNGGNACTANNNNNTGGCGTAATCATGNCATAGCTGTNNCTGNN
Quality >S03036-01_P05.phd
5 4 3 3 3 3 4 7 6 4 7 8 3 9 8 5 5
8 7 6 3 5 3 3 5 9 13 21 6 26 22 15 29 40
10 11 41 16 9 21 10 15 29 31 42 52 24 30 31 41 32
18 24 46 50 25 21 39 41 17 9 37 40 32 28 51 52 33
31 43 52 52 50 52 49 53 52 51 43 42 49 52 31 42 49
49 35 28 50 54 54 37 54 49 51 45 50 54 34 49 46 49
50 54 49 46 46 45 39 42 49 49 50 50 59 59 57 57 50
54 54 54 57 57 57 54 59 59 57 54 52 50 57 57 50 57
51 51 51 45 59 54 58 58 50 63 50 52 57 63 63 63 54
50 63 51 49 63 60 63 63 60 50 63 63 54 54 50 63 50
50 54 63 60 58 54 44 63 58 57 60 54 60 52 54 58 54
59 60 54 50 50 53 53 46 45 46 43 49 50 54 51 57 42
52 59 53 53 50 53 54 54 42 44 50 50 54 43 50 52 54
53 44 57 59 59 30 50 44 38 57 44 36 57 42 50 59 54
53 43 43 36 57 42 42 49 44 57 51 39 39 50 54 57 54
39 43 43 46 34 42 54 52 57 53 43 57 34 59 57 39 57
35 39 50 54 44 50 42 44 57 43 42 42 31 42 57 44 44
43 57 57 44 50 44 24 42 42 57 35 33 34 30 30 35 30
29 44 32 35 30 28 35 53 27 35 51 31 37 39 18 40 21
26 45 27 35 53 32 19 53 19 49 26 50 28 36 31 36 28
44 28 41 31 27 52 23 52 53 28 42 42 21 35 31 50 31
36 43 53 30 32 28 46 21 41 50 42 19 49 17 52 41 50
36 35 39 53 51 30 30 49 27 49 28 50 38 43 44 51 51
31 33 50 27 52 34 46 35 32 51 51 51 30 23 49 24 52
38 37 32 28 39 52 52 33 29 49 22 51 35 49 49 28 52
41 28 52 31 47 18 52 31 31 39 36 33 37 33 40 23 27
44 52 36 35 46 28 51 31 30 34 30 21 46 29 31 31 26
33 35 35 52 31 42 21 27 27 31 35 33 28 48 25 48 20
48 20 34 52 52 35 26 48 23 32 37 40 31 21 42 29 52
31 31 29 26 32 47 33 17 52 31 46 20 36 38 47 21 35
30 31 31 21 39 31 27 31 52 46 31 20 46 29 9 46 43
20 27 52 20 47 31 30 27 44 27 20 47 20 46 27 47 43
47 27 17 47 52 14 46 29 33 30 32 23 29 24 24 30 26
28 34 20 17 21 30 20 30 16 3 13 16 47 16 28 31 28
16 23 20 41 18 31 28 25 19 9 42 28 27 28 20 27 27
21 21 12 25 18 27 13 16 12 18 15 19 31 23 24 22 16
6 3 9 16 8 16 27 16 37 10 34 6 14 6 27 12 5
8 9 26 29 31 5 13 3 5 12 3 9 19 3 8 12 8
13 3 12 14 21 5 13 5 6 33 14 16 19 24 24 21 17
15 14 24 15 15 16 5 12 8 21 26 26 30 26 35 17 14
37 13 15 26 19 11 12 8 22 16 29 29 23 17 12 8 25
17 20 20 22 30 10 3 20 21 11 23 16 24 21 19 29 25
13 12 14 14 13 16 8 29 5 25 8 21 5 3 5 8 10
8 17 3 3 16 10 7 7 20 11 14 12 17 7 9 13 10
7 8 12 19 24 6 17 6 15 9 5 6 7 6 9 9 7
24 9 13 13 12 13 15 3 6 6 10 10 15 5 8 7 7
7 13 9 9 13 6 3 8 17 5 9 26 12 16 5 2 4
3 6 26 13 27 15 15 14 24 26 12 11 8 11 25 6 13
12 10 9 10 22 14 19 16 6 5 14 8 16 5 6