S03036-01_P08
Seqid S03036-01_P08
Sequence >S03036-01_P08.phd
GNNNTNNNNNTTTTTTNGGGCCCCNNCNNNGGGNNNNNTGGCGGCCAAATCGGCCGAATT
GGAATAGANAAATACTAAGCAAAATTTCAAAATCAAGTTAGTGATGGGTGTTTATTTGGC
AGTACTCTTTTCGTTACTGGTCATCGAAATGGCCATTCTGTTTATTTTGGTACTTCCGCT
TCCACAGCGTATGAGAAGGTGGCTGTATATACGCTACAGTATCATAAGTACTAATAAGAA
ATTCAGAACTTATATGGTTGGAATCATGATCTTCGTTGGTCTTTTGTTCATCGATTCATG
GAAAAGGTCACAGATCAAAGTGTCTACGTACCGCANCCAGGACATCCCTATCNGTAAATA
GGGGGACNCCGATGGATGCACGTGCTTCATGACNNNAAAAAAAAAANAGCGAAANAGGAA
ATAAAATATATAAAAAGAAATATAAGGAAAAGAAGAAAAANAACCCNGACGCGGNGAGAA
NAAGGAGGGAGAAAANNAAACAAAATTATAGAATATAAAAAAGCAAAACAAAGAGCAGGG
GGAGGACGAATGGATAATGGAAAAAGATNAGGAAGTGAAGAAGGGCCTTCATGTAAGGGA
GCGAGGGGGAGTANGGTAAAACATAAATNAGNTGAGGCTTCAAAANAAAACTTAAAAAAA
GCCAAGTGTTATGAGGATAACANTTNATATNNAANCATAGGACCTCCAGATNNCGAAAAT
CTNGAAAAAAANAGGANNATGGAAAAAGNAAAAATACNAAATAACNTANCCAACTGTGTA
GTANATATATNNATTTCAAAAAATAAAANGAAAGTGAGATGACTTNNAACTNAGTATGGG
ACCAAAAGNNAGTN
Quality >S03036-01_P08.phd
8 3 4 6 23 7 3 5 5 3 10 20 27 15 9 9 6
31 15 12 15 12 9 8 7 3 8 7 7 7 8 12 19 7
5 3 5 7 19 35 28 11 35 29 19 13 12 18 22 38 36
49 30 35 35 24 30 11 38 46 46 30 10 15 35 46 46 15
7 29 39 13 46 53 52 52 53 60 47 53 46 53 60 53 42
57 60 40 11 33 53 45 53 52 53 52 52 57 52 42 32 40
53 42 46 57 57 52 52 52 52 60 52 60 52 53 53 57 63
57 63 63 57 52 52 57 57 60 60 57 53 58 57 63 52 57
63 57 58 52 60 52 53 53 57 47 53 57 57 52 57 53 52
63 52 58 58 60 60 63 57 57 52 60 52 60 57 52 57 63
57 57 52 57 53 60 52 52 52 57 58 60 52 52 57 52 53
60 60 57 57 53 57 58 60 63 57 58 53 52 60 53 52 57
60 57 57 57 57 57 57 63 53 57 52 60 57 52 60 57 60
57 53 57 57 57 52 52 57 57 52 46 45 37 53 53 53 53
57 53 53 53 53 53 39 53 58 52 52 58 60 52 52 57 58
57 52 57 53 60 52 60 53 53 57 46 52 52 52 52 52 52
52 52 32 42 53 53 53 45 47 38 53 60 53 53 45 45 35
19 42 33 32 27 28 46 46 27 37 53 35 48 53 53 28 20
35 12 9 9 23 16 9 14 12 9 27 9 9 9 11 22 18
32 23 45 35 28 41 32 40 11 8 14 11 6 14 11 11 11
8 11 9 9 15 26 15 18 19 10 9 11 7 10 14 9 9
11 13 9 11 9 28 12 11 9 9 7 9 9 8 9 10 18
9 19 9 14 13 10 15 21 9 9 19 15 20 14 11 9 10
11 12 6 6 6 9 14 19 20 11 24 19 27 11 12 6 9
11 10 8 14 31 24 6 16 15 12 19 18 14 8 11 9 10
14 11 10 9 8 11 16 12 17 18 13 11 12 9 13 13 10
21 10 15 11 9 11 22 20 23 13 13 21 16 14 11 9 14
11 6 10 12 14 14 11 6 8 10 25 9 10 11 10 6 12
10 9 11 10 7 11 9 9 9 11 9 11 16 17 14 10 11
12 9 6 7 17 20 14 14 11 11 17 13 13 10 11 19 20
17 19 23 11 11 9 10 11 10 20 11 11 17 17 11 13 18
13 14 14 10 10 10 17 11 8 13 14 16 13 11 18 14 11
9 15 11 15 14 16 13 10 10 19 10 18 9 10 14 16 13
26 11 13 11 8 15 9 6 12 14 16 14 13 13 9 10 12
14 16 16 14 15 11 10 13 11 17 15 13 13 12 11 8 9
8 14 13 11 19 16 13 12 19 22 11 13 19 20 18 17 12
9 6 10 10 8 18 18 11 11 13 14 17 15 13 11 9 6
11 8 6 9 9 20 16 10 11 11 9 18 19 16 13 12 6
11 10 10 11 8 11 13 21 9 10 21 13 10 10 8 10 10
9 13 9 9 14 17 18 17 14 11 14 14 18 22 11 14 8
9 9 7 14 11 7 11 11 10 10 6 6 34 18 6 11 32
11 27 18 9 9 11 11 15 14 12 11 13 19 11 6 6 10
9 10 25 11 19 8 14 10 6 9 13 11 10 11 9 14 10
6 10 11 8 9 7 7 25 13 9 9 14 24 9 34 10 9
6 10 21 24 32 22 8 9 9 7 19 13 14 9 14 13 11
7 10 9 6 11 8 18 14 11 10 11 14 10 10 14 10 9
11 7 15 12 18 11 14 10 7 7 23 14 11 10 10 8 14
10 9 11 22 9 23 14 15 17 7 8 11 23 12 10 12 8
10 8 15 10 9 10 14 9 8 6 7 10 19 10 11 7 12
20 9 9 10 18 24 16 16 11 16 11 9 9 8 8 6 6
11 11 9 6