S03036-01_P09
Seqid S03036-01_P09
Sequence >S03036-01_P09.phd
NNNNNNNNNNNTNTTNNGNNNNNNAAAANNNNNNNNATTGGCGGCCAATCGGCCGAATTA
TATATGTATATTATACTCTAGAAAATATTTTTACCGTTCTAAAAAAAAAAAAAAAAAAAA
ANAAANNAAAANNANAAAAAATAAAAAAAAGAAAAAAAANAAAANNNACCGGCCATAAGG
GCCAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTG
TTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATA
AAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTANTTGCGTNGCGCTCA
CTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAACTGCTTTAATGAATCGGCCAACAC
CGGGGGNNAANGGGAAAGGNNATAGGGNGCCCTTACGATTACTCGNTACCGGAAACNTTT
TCAANCCATATNAGGAGNCNNTGGAACAGNTNAGATAAATATAAAGCAAANNNNAANAAT
AGATATTAANCTTAGTNNNCCNNGATAAGATNGTCTNGAAGANNGNAGAANATAATGGGG
NAAGNNNCCGGTGAACAAATTATCTNNGNGNNAGNTGTGNTTTACTAAANAGCANTTAAT
GNTTTNAAANAANNGTTTNNNGACNATNACCNTNTAGNATGANCAAATATATNAANAANC
NNGATTAATTNANNAAANTAANACATTTAANATGTTNNNTAAATAATNNNNTNCAATNNA
AGNAAATNACNAANTATANAAGANCGTTATNTAAAAATATAAGACNCTTNNANATAANTG
GN
Quality >S03036-01_P09.phd
6 5 3 5 5 3 3 6 7 6 3 10 7 21 8 5 5
14 5 5 7 3 3 3 9 8 9 11 7 5 6 5 3 3
5 7 15 11 19 26 14 12 35 32 16 12 12 9 19 26 18
15 21 28 22 16 18 32 42 14 50 22 37 40 37 42 42 41
50 30 50 44 42 50 52 38 41 36 31 31 42 23 21 20 41
36 41 28 27 32 49 30 33 50 49 46 46 42 49 43 29 15
32 37 32 35 34 38 30 20 26 27 35 28 28 18 29 18 21
14 20 7 8 10 14 6 6 8 8 12 13 3 3 13 5 20
17 21 31 18 16 11 23 25 21 21 14 14 20 31 11 27 29
15 29 30 9 21 12 5 9 12 12 16 5 3 6 10 47 32
40 40 46 40 32 36 34 32 42 47 19 37 37 26 34 37 38
45 30 41 26 44 31 35 31 46 17 42 19 37 40 40 52 25
32 17 31 25 28 40 25 27 26 25 26 36 23 16 41 34 39
40 31 33 27 29 42 22 33 52 46 26 33 31 19 41 29 27
29 42 31 42 23 16 16 14 47 23 48 25 26 16 16 17 20
23 28 28 26 18 29 21 21 16 40 33 29 23 20 29 29 20
25 22 36 14 31 22 23 27 28 24 26 32 29 33 30 41 26
27 18 14 13 14 31 20 34 18 31 25 25 32 24 19 29 21
30 43 26 24 31 15 23 29 18 15 17 14 30 13 13 9 35
50 18 35 30 20 27 26 24 17 35 19 21 27 18 18 23 15
26 17 13 13 13 7 14 13 10 12 17 13 5 8 9 9 21
21 10 13 15 20 24 11 21 15 16 20 23 21 21 9 14 13
11 32 27 24 20 27 28 35 27 17 19 15 15 16 21 9 27
26 35 35 14 9 20 29 12 20 10 37 18 19 32 14 16 29
21 17 18 12 21 19 15 27 44 12 9 16 10 11 13 20 16
10 6 7 10 9 6 10 10 11 9 9 8 19 12 6 6 14
15 11 19 19 12 7 11 19 9 14 11 14 22 10 15 11 10
12 10 11 14 9 12 7 9 14 10 10 9 9 18 10 11 8
6 11 10 15 11 19 10 11 7 11 9 9 14 11 10 6 19
17 9 9 10 6 9 6 6 14 9 9 9 8 9 10 14 6
9 6 11 11 13 11 8 14 14 9 10 14 12 20 11 10 12
11 10 10 6 6 7 6 11 12 6 11 8 9 9 9 10 11
11 9 8 9 11 6 8 9 9 10 10 10 6 6 7 9 11
6 6 10 10 10 9 19 10 13 9 6 11 10 8 11 6 11
11 11 8 8 7 7 9 6 9 11 10 9 6 9 11 11 8
9 11 8 10 11 6 8 9 9 6 6 6 8 8 9 10 9
9 8 10 9 10 19 9 14 10 9 9 11 9 6 6 9 6
10 6 6 11 8 7 9 9 9 8 6 10 11 9 10 11 10
18 18 9 6 8 9 9 9 6 9 9 10 11 12 9 7 10
9 11 6 8 10 11 6 14 11 6 6 10 9 8 14 6 6
6 9 8 9 6 14 9 6 9 10 8 7 8 6 10 9 9
6 14 14 9 10 6 9 8 14 11 9 8 11 14 10 6 14
9 6 8 10 6 9 7 6 11 10 9 9 8 9 9 22 6
10 6 6 10 10 9 6 9 11 9 6 10 9 9 14 9 9
9 11 6 9 9 9 9 11 6 6 6 8 11 16 8 8 10
8 9 6 6 6 6 9 6 8 18 8 8 6 6 11 10 10
6 14 14 8 9 7 14 9 6 14 10 7 10 10 10 9 6
14 11 8 8 6 9 9 11 19 9 10 6 9 14 14 14 16
10 11 16 10 9 10 10 9 8 6 11 10 9 6 6 10 6
14 9 9 14 6 10 11 9 6