S03036-01_P10
Seqid S03036-01_P10
Sequence >S03036-01_P10.phd
NNNNNNNNNNTTTNGNNNCNCNNNNNNNNGGGNNNTTGGCGGCCAAATCGGCCGAATTGC
GAGCTCCTAACACCAAGCAGAAAAAGGNCTTTTTCGCAAAAACATTAACATATATAAAAC
TAGCGCTATGGCCGCAACTAAAGAAGCAAAGCAACCAAAGGAACCAAAGAAGAGGACCAC
CAGGAGAAAGAAGGATCCTAACGCCCCTAAGAGGGGCTTGTCAGCTTACATGTTCTTTGC
TAATGAAAACAGAGATATTGTCCGTTCCGAGAATCCTGACGTAACTTTTGGCCAAGTAGG
CAGAATATTGGGTGAGAAGTGGAAGGCCTTAACTGCTGAAGAAAAGCAACCCTATGAATC
TAAGGCTCAAGCAGACAAGAAGAGATACGAATCTGAAAAGGAATTGTACAATGCTACACG
TGCTTAGTCTAACAACTCAATGTTCTCTACCCCCCATACAACGTACTTTTGAAACTTCAG
AAAGAAGTTGAGNANGTTGGATTANNNNTTAATAATATTATTATTANATNAGTTTGATTA
GATATCCGNCGTTGGNGTNNGTATATAGATTTTTGTAGGCCTCAAAGANAGTNATTNAGA
GAGGATGAAAGAAGGGGAAAGAACGGAAGNAAAANGTGAGAANAAAAAGGAAAGGAAGAG
AAAGGGNTAAACNAGGATCNNAAGNGNCAGGTAAANTGAGGAANGCGCNGNTTTNNNNAA
TNNNNNTCATATNNANANGTNNTNGAGNNATAAATAANNGATGANAAAANGTANNCGNAG
GAAGNGAGAGTGGGGAGGGACGAGGAAAAATNTNTNAGGAAAATATAAGGGGNNNACGGG
GTAANNAGAGTATTGNAAN
Quality >S03036-01_P10.phd
4 3 3 4 3 4 4 3 3 5 10 8 9 5 9 5 5
5 8 5 8 5 3 3 5 3 7 7 6 10 8 8 3 3
7 10 12 29 22 12 40 24 15 22 12 13 8 18 18 30 27
29 30 31 26 19 30 36 30 23 26 34 36 36 36 42 43 35
35 41 35 26 36 30 30 43 36 31 30 46 50 46 50 54 23
20 20 5 9 35 54 54 49 44 44 34 43 39 38 47 60 50
60 47 44 44 49 47 50 44 49 54 57 60 57 57 60 60 57
52 52 52 57 60 43 52 52 57 60 52 52 52 63 63 63 57
60 53 52 52 57 60 63 63 63 63 63 63 63 63 63 60 57
60 63 53 63 63 53 63 63 63 52 63 63 53 60 57 52 63
63 57 63 63 53 37 46 63 60 63 63 58 63 63 63 52 63
63 63 63 63 63 53 63 48 42 53 63 63 63 63 63 63 63
63 63 63 63 63 63 63 63 63 63 63 63 63 63 63 63 63
63 57 63 63 63 53 57 60 57 63 63 63 63 63 63 63 63
63 53 52 52 63 58 63 63 63 63 57 60 52 63 63 52 48
52 52 57 63 63 63 57 63 58 59 63 57 63 60 63 52 63
57 40 53 63 57 63 58 52 60 53 57 63 60 58 60 60 60
63 52 46 63 40 63 60 63 60 52 63 57 60 43 41 43 57
57 52 58 58 58 58 57 63 57 42 43 33 35 57 52 63 45
43 44 63 25 43 47 43 43 43 42 46 60 57 57 60 52 52
52 57 57 52 60 52 52 47 52 60 57 60 52 57 48 60 57
48 48 48 52 52 57 52 52 46 57 52 35 43 43 52 52 39
52 47 52 60 57 48 41 43 53 42 48 42 34 52 35 57 52
52 57 57 60 35 23 34 43 48 57 43 40 37 43 52 46 60
57 41 46 47 57 37 60 52 60 53 22 15 45 60 22 22 32
14 8 13 42 52 53 53 53 53 52 43 35 39 32 39 53 43
31 14 42 41 46 41 42 53 53 60 57 53 53 38 24 30 34
9 8 12 44 19 21 34 18 42 33 35 17 11 9 11 47 34
53 41 26 18 18 13 11 11 26 19 29 41 14 16 24 19 6
9 6 14 14 18 24 10 10 8 8 14 7 6 6 6 21 19
22 12 15 16 9 14 17 11 9 14 9 14 20 10 9 11 6
10 11 6 12 11 12 10 9 13 18 9 18 12 9 11 9 11
11 14 13 11 7 15 12 15 19 17 11 6 10 19 6 6 15
10 10 10 9 9 11 11 10 8 10 12 9 10 8 10 10 10
11 11 9 9 10 12 14 18 8 9 6 8 8 9 6 11 9
9 7 15 14 11 14 11 16 12 10 8 10 12 10 9 9 13
10 9 11 9 14 12 11 9 9 14 9 11 11 20 10 15 10
6 8 8 9 8 6 9 11 16 13 10 10 9 6 9 13 17
12 18 10 11 9 9 10 8 10 13 10 10 14 10 12 10 9
9 9 11 6 9 9 10 11 8 7 9 8 10 10 11 11 6
6 10 14 8 6 9 6 9 15 10 11 9 14 11 9 6 11
10 9 9 14 11 8 6 10 9 8 11 6 10 6 8 11 9
6 7 6 7 10 10 8 6 6 7 7 6 11 9 12 9 11
10 6 7 9 6 10 6 9 10 7 6 9 6 14 10 9 6
6 14 10 10 14 14 9 10 9 6 6 10 9 14 10 9 6
9 9 10 9 7 11 8 11 6 6 14 14 6 9 14 9 9
11 9 7 11 14 14 14 10 14 10 10 9 19 9 14 14 9
9 10 9 14 8 9 10 18 10 10 14 11 7 9 6 11 6
14 10 12 10 10 10 9 8 9 8 9 14 11 14 11 8 6
7 6 9 10 8 8 9 9 8 11 9 6 6 9 10 10 11
11 14 9 11 9 6 10 10 6