S03036-01_P15
Seqid S03036-01_P15
Sequence >S03036-01_P15.phd
NNNNNNNNNNTTNNNNGCNNNNNANANNNNNGATTGGCGGCCAATCGGCCGAATTGGAGA
AGATCGTGTTTATTGCTTTTCTCAAAAAGACTAATCAATTAGAATAACAAAAGAAACATA
TACATATAATGACTGAATTGTGTCCTGTCTACGCCCCTTTCTTTGGTGCCATTGGTTGTG
CCTCTGCAATTATCTTCACCTCATTAGGTGCTGCTTACGGTACTGCTAAGTCTGGTGTTG
GTATCTGTGCCACTTGTGTGTTGAGACCAGACCTATTATTCAAGAACATTGTTCCTGTTA
TTATGGCTGGTATCATTGCCATTTACGGTTTAGTTGTTTCCGTTTTGGTTTGGGATTCGT
TGAGTCAAAAGCAATNNNTGTNCAANGGTTACATCCAAAAGGGCGCCGCGCAGTTATGNG
GGTTGAAGGGCAAGGANAATGAAGGTNAAGNTCTTTGAACGCTTGTCCTNACCGGAGTGA
GAAGGGNAGTACAAAAACCAGCATCTNGGATTTTATTANTGTATTAACTCCACGGAACNN
CAANNCAACNGNAAGAGNNNAGCCGANNATGNNANGAAAATGTANGNNANNTANAAGAAG
NGATAGTAGNAGCAAGNTACAGNGATANAAAGTATGGGGCANTAGANGNNGAGGAAGTAA
AAAANTAGTNATTTNNTTCNTNNNCGNTNNNAANANNATAGTCCGACNCTCNTNNNNNTG
GGGTCNNGTAGNACGGAGGACTNNAACCTATTTTNNAAGAGANCTTGAGTNNNGAGCCGA
CGAAATAGNGATTATTATNGTGNGNANTCGCAAAANTCANTGATNGTTAAANGNAGATCT
TGTNGAGGTAANAGNNAAACTTGNNTTGNNATGATT
Quality >S03036-01_P15.phd
4 3 3 6 4 5 4 3 5 7 11 10 5 5 3 5 9
10 6 7 7 7 6 10 6 8 5 7 3 5 5 17 22 15
21 24 11 14 19 21 12 14 14 17 35 37 28 21 16 31 30
25 23 26 34 27 14 23 11 27 25 17 29 8 44 29 38 42
49 40 17 32 26 41 42 35 37 43 37 36 46 32 30 12 18
28 32 42 43 28 33 42 33 35 39 44 22 42 42 38 36 44
42 35 28 27 23 35 31 21 29 24 34 57 60 47 60 46 60
48 53 60 58 42 58 57 58 52 48 53 63 53 48 60 57 52
60 52 60 52 52 58 48 63 63 60 63 53 63 52 57 52 60
60 57 57 52 57 60 53 60 60 53 58 52 53 57 52 52 53
53 53 53 53 60 57 53 53 53 52 57 53 53 53 53 53 52
53 63 57 53 53 53 53 53 53 53 42 57 53 46 53 53 57
53 53 53 46 53 53 35 53 53 53 53 53 53 52 47 53 53
52 53 52 53 42 53 53 46 35 37 46 53 53 60 42 60 32
53 53 53 53 44 53 53 53 53 53 53 53 53 42 53 53 53
53 53 46 46 57 53 53 53 53 45 48 35 53 25 42 41 27
53 53 53 45 53 53 42 60 52 40 48 53 52 52 52 23 52
53 37 42 57 53 53 47 53 41 53 29 35 43 27 35 24 14
29 44 36 33 27 45 35 32 22 25 35 43 37 48 36 45 43
24 16 21 22 48 22 41 30 26 20 44 42 42 24 16 20 22
35 16 28 41 41 35 42 28 16 22 12 16 10 16 11 14 10
13 15 14 11 10 8 8 9 9 9 16 31 17 13 17 11 16
9 7 5 6 16 9 13 7 13 10 13 6 10 11 32 18 11
9 14 19 21 29 18 16 9 12 14 19 14 10 11 9 12 9
11 11 9 10 8 9 9 8 9 11 6 11 9 10 23 14 11
14 9 25 10 19 10 9 10 11 9 9 6 9 14 12 9 9
9 8 11 14 7 12 10 12 6 11 8 19 13 10 16 11 10
9 8 9 8 8 9 10 12 9 9 7 9 12 10 9 10 19
13 9 11 16 23 9 9 11 8 9 6 9 20 16 9 11 9
11 19 20 12 17 13 11 9 9 9 10 11 15 6 8 9 9
9 11 10 10 9 8 11 10 6 11 9 9 9 11 9 14 14
11 8 10 14 10 11 16 10 11 11 14 6 6 9 11 9 6
7 11 8 10 11 6 9 6 11 9 9 9 8 6 6 6 10
9 8 9 9 9 6 6 10 9 8 7 6 11 6 9 16 14
16 16 8 9 8 8 6 8 6 6 10 6 7 8 11 7 8
9 11 10 8 11 6 10 8 10 14 10 10 9 9 6 9 9
9 12 12 11 6 9 10 11 8 11 7 8 9 10 12 6 14
12 8 9 11 9 11 9 9 9 10 9 10 6 9 14 10 14
7 9 6 7 10 9 11 9 11 9 8 8 9 14 8 14 10
10 7 9 15 11 14 6 14 8 14 8 6 6 14 9 9 7
11 6 7 5 9 9 6 11 6 6 5 19 14 6 10 6 6
9 9 10 9 10 10 9 8 10 9 6 9 9 10 6 11 6
6 6 6 6 9 10 11 9 8 11 9 7 6 10 9 11 11
6 9 8 10 8 10 11 10 8 8 14 5 5 10 9 9 10
10 11 11 12 10 11 6 6 8 8 9 14 11 9 7 9 8
11 9 11 11 10 6 6 6 8 14 11 8 8 11 9 11 9
9 14 8 10 9 11 6 8 9 9 10 14 11 11 10 9 7
11 11 10 6 9 6 14 7 9 11 9 10 8 11 10 10 6
8 8 10 7 10 10 11 11 6 8 9 11 14 14 8 6 9
7 14 9 10 10 10 9 9 10 8 6 9 10 11 10 8 9
10 6 9 9 6 6 8 9 14 10 11 10 10 6 7 11 10
11 6 6 10 8 10 9 10 8