S03036-01_P16
Seqid S03036-01_P16
Sequence >S03036-01_P16.phd
NNNNNNNNNTTTNTNGGGCCCTCTCAATANGGCGANTGGCGGCCNATCGGCCGAATTTGA
CTGTCGTTTATAATTTGATTTACTAATCGCATCTGTATTTGGAAAAGCATTTCTTTTTGG
AAGAGGAACAAGAACGCCATGTCAGCAGACGAAACGGATGCGAAATTTCATCCATTAGAA
ACAGATCTGCAATCTGATACAGCGGCTGCAACATCAACGGCAGCAGCTTCACGCAGTCCC
TCTCTTCGAGAGAAGCCCATAGAGATGCCCTTGGATATGGGAAAAGCGCCTTCTCCAAGA
GGCGAAGATCAACGGGTTACAAATGAAGAAGATTTCTTTTTGTTTAACAGATTGCGGGCA
TCACAGAATAGAGTTATGGACTCCTTGGAACCACAACAACAGTCATAGTATACATCTTCC
ANTGTCAGTACGATGGAACCATCTGCCGACTTTACTAGTTTCTCNGCAGTGACTACTTGA
CCGCCTCCGGCTGATCATCGNCAACAGCAACTNNNNTTAGCAGCAGCAACAGCAGCAGGG
GAACNTGGTGGATCAAGCCAGTATACCCAAAAAGAAACGAACTTGGAAAGCCAAATTTTG
GGGGGNAGGAGTAAGAGANNAAACGTAATAGGTTTTATGATTTGAGTGATTCANAATTTN
GGAANAAGGAAATACAANAGATAATTCATGAGANNATTAANCAAGATGAAACAAAAGANA
ACCNAAGAGAAGCAAGNCTCAAGCNAGGGTNAGATAANGGAGTATAGANAAANAANGATA
AGGAATATTTAAAACCGNNNAANTGAAGGNAAAGGGGTNNGAGAAGAAGAATAAAGGACA
ANAGCGAANAACAGTTGCTGCACAGGGGAGAGNGNGAGNNGNGCGGGGNATAAATTTGAG
NNN
Quality >S03036-01_P16.phd
5 5 3 3 4 4 4 3 3 9 19 11 6 11 6 33 18
12 11 13 13 9 8 8 10 9 12 8 9 6 17 21 10 11
9 7 10 31 16 10 30 31 12 11 7 10 41 41 44 35 31
38 36 32 16 30 46 34 33 21 20 46 50 46 46 46 49 46
22 29 35 25 46 42 49 46 54 41 38 49 42 43 38 30 32
33 42 49 44 59 46 49 50 42 44 29 39 42 60 60 50 44
33 35 42 42 42 47 42 44 60 50 50 60 60 58 60 60 63
58 52 43 57 63 52 60 52 46 52 60 52 63 63 52 63 58
58 52 52 58 63 63 52 52 57 58 59 57 52 52 57 63 63
57 52 57 60 58 52 63 58 63 63 63 63 52 63 63 52 47
63 63 63 52 63 63 63 57 63 63 58 60 52 59 63 52 63
63 63 57 57 63 63 63 58 63 63 60 60 60 52 63 63 63
58 58 58 58 58 59 59 60 54 63 63 57 58 63 63 63 58
60 52 57 57 57 57 63 63 60 57 52 63 63 63 42 63 63
63 63 63 52 63 58 63 63 57 57 58 52 63 44 63 58 57
52 63 52 47 57 57 52 63 52 52 42 52 52 60 63 60 52
52 57 52 34 47 52 58 63 63 52 43 43 41 52 52 52 42
43 60 57 57 52 57 42 22 45 60 52 35 58 46 52 46 41
28 52 21 57 47 63 60 57 63 43 43 60 52 47 47 45 60
57 57 43 41 35 29 33 40 52 29 42 43 43 46 60 57 57
47 42 28 43 41 22 16 30 31 32 47 35 47 52 39 46 43
46 35 40 60 57 57 57 52 47 60 59 57 57 57 48 48 48
47 46 42 48 35 34 52 57 42 40 34 35 43 19 41 52 52
52 42 34 21 25 43 48 43 52 20 42 44 47 42 57 32 19
16 24 27 23 46 47 57 46 35 35 40 31 10 5 9 40 34
32 24 11 16 26 40 28 43 32 16 16 16 13 34 37 20 30
20 17 30 19 17 29 37 27 24 35 31 30 34 18 19 21 41
37 23 27 19 18 6 9 12 20 13 11 24 22 42 31 32 33
11 9 9 9 14 16 19 11 13 13 14 9 11 11 9 13 10
20 18 13 11 8 13 11 6 13 27 23 22 14 17 19 11 11
14 13 7 6 6 6 10 9 11 13 13 9 12 13 16 18 20
18 9 17 16 22 9 11 18 9 9 9 9 9 13 11 10 8
6 10 18 16 21 20 26 11 11 10 10 12 20 24 18 9 10
9 9 10 16 13 13 11 11 16 29 14 24 9 14 33 19 9
9 9 19 14 16 18 23 13 24 12 22 12 14 11 16 19 17
11 19 14 9 9 9 8 11 11 11 6 9 8 10 11 14 9
10 9 10 9 9 11 6 6 23 17 12 14 8 10 9 9 12
8 8 13 23 15 18 9 9 14 19 10 9 11 10 10 10 9
11 9 10 10 10 9 8 6 11 13 28 14 10 7 9 10 9
16 6 14 11 11 24 24 11 10 13 10 9 10 11 7 24 10
14 14 12 14 9 9 9 15 13 8 10 13 11 6 6 12 10
9 10 11 6 9 19 18 10 8 11 10 11 9 11 10 10 11
11 10 22 21 6 14 13 9 9 6 12 14 8 8 14 17 13
9 10 13 9 9 6 12 9 11 11 16 11 11 6 8 9 9
9 11 6 9 9 10 9 10 11 7 11 9 9 9 8 11 10
10 14 8 6 10 14 9 6 11 12 6 12 11 11 16 11 11
9 9 12 10 9 9 9 14 12 16 19 15 15 13 8 6 7
6 14 18 6 9 16 10 18 13 10 7 10 9 11 10 9 11
9 11 6 6 8 8 9 8 8 12 14 9 9 11 14 9 14
11 9 11 8 10 8 11 11 6 11 9 15 9 15 18 7 9
9 9 9 9 10 9 9 9 8 15 14 9 11 14 10 13 9
8 8 11 9 8 6 11 6 8 10 14 6 6 9 6 19 11
9 9 14 10 6 8 10 12 11 19 11 11 9 9 10 9 6
6 6