S03036-01_P17
Seqid S03036-01_P17
Sequence >S03036-01_P17.phd
NNNNNNNNNNNTTNNNNNNNNNNNCNNNNNGGCGATTGGCGGCCAATCGGCCGAATTGAG
CGTAATTATGTCTGAATCATCTATTTCTTCTTCTAAACCATCTGTGGAATTGCCACAAGC
AACCTGGTCGCATTTGCAAAGATACCCAGCTTTATCCAAGTTTATTAAATATGCGGAATC
TCTGCCACCTGTGGAGAGATTGATTTCCTTCAACCTCGTTGTTTTGGGATCTGTGAACCA
GTGGGTTTCCGAATCGTCCAGCTCTCCTCGTCTGGTGAAGCAAGTTGTTGCTGCTGGGAA
GGAAGGGGCCTTCAAGTTGGATGAGTTAGTCTGTACAATTGGAAATCACATTCCAACACG
CCAGGGATCTGGCTGGTATGGTTTTTCGTCGACTACGTCGCCAACATTTCTAATACTCTG
TTGAAGGGATTTCTGATCAAGACATTGGACTTGCAAAGTTCTTCCGCATCGAGAGAAATC
GGCTCTTCCAGTGANGATAACAAAGTCCAGGANGGTACTTCCTTGGAACAAAAGGCCCAA
TTCCCCCCCCCCCCGCAGGGAGTGGGAGGAGAAAGANTACTGGTTCAAATTTATTTTTTT
GGCCCGGAAGGAGGGCGGGGAGGGGGGANGTTATAAGTTTAATTTAAAATAAAAAAAAGA
TAAAATTCCCCTCCTGGCACATTCAAGGAAAAGAGGGAGAAGAAAAAATCCTTCAAATTT
TTTTAAAAATGAATTGAAAAAAAGGGAAACCATATTGCGGTGGTCTTTTTAGAAAGGGGA
AAGACGGAAAAATAAATATTTTAGTNGATTAGGGAAGGGGAGGGGGGCGAGAGGATGTTT
GGGGGTTTGTATGCTGGGGGGGGGGGG
Quality >S03036-01_P17.phd
5 3 3 6 5 4 6 6 4 3 2 11 14 5 6 7 7
5 5 3 3 3 3 3 9 5 5 5 6 3 15 15 12 25
25 12 31 31 16 14 46 27 18 17 26 32 44 42 46 23 36
43 35 31 16 25 52 42 44 37 43 36 26 32 28 35 31 27
34 37 47 42 41 49 50 19 31 28 25 41 49 43 49 50 49
49 49 49 49 49 46 49 49 32 28 31 46 49 42 23 40 46
49 49 49 53 31 31 36 30 49 43 42 29 37 40 34 30 41
43 37 40 49 49 50 57 51 49 49 47 54 54 45 43 53 49
49 37 42 46 54 41 33 54 43 53 50 42 50 57 57 53 42
42 49 52 50 19 51 49 50 51 52 43 44 51 46 49 46 49
42 50 50 49 49 53 42 43 42 50 50 49 49 46 49 51 35
54 53 45 44 45 43 53 45 33 51 36 34 21 53 49 42 36
57 53 50 57 43 51 39 21 50 46 53 47 60 44 54 49 60
35 49 60 50 49 63 60 33 22 47 47 50 42 47 39 63 42
51 42 47 47 60 58 63 42 63 63 27 42 42 47 63 40 42
35 42 42 63 27 44 47 49 35 42 35 63 49 60 44 50 47
43 54 57 31 50 27 57 27 54 29 57 43 31 59 44 31 59
43 31 50 50 35 59 42 57 57 38 57 19 57 34 57 27 57
57 54 31 57 39 57 44 17 45 31 34 50 43 59 44 21 42
42 17 54 54 35 28 15 11 59 42 54 35 39 35 39 31 54
42 44 50 59 54 39 39 39 42 42 54 54 34 44 31 59 44
34 39 39 54 46 39 19 57 54 44 44 46 42 42 50 39 54
35 54 19 16 27 25 24 35 50 42 35 35 47 44 44 44 33
38 18 13 24 27 19 35 25 21 20 32 24 52 32 35 44 38
27 24 35 14 16 17 19 25 29 30 29 35 46 20 15 13 14
19 13 11 11 31 20 31 14 19 25 41 19 16 22 17 10 10
12 17 20 23 19 11 11 22 32 40 22 19 11 12 12 15 12
23 21 9 10 12 23 24 19 17 14 9 9 46 11 10 50 26
19 31 31 10 11 13 16 20 18 12 20 13 22 13 11 10 11
11 6 18 14 14 16 36 12 14 28 17 13 10 9 11 14 13
13 23 7 12 11 10 9 9 9 13 11 11 13 14 15 10 9
11 10 9 18 17 17 17 17 17 17 13 14 14 14 16 15 18
24 24 12 20 14 14 15 12 11 9 14 13 18 15 22 11 13
9 11 10 11 14 13 17 19 11 10 11 9 8 9 9 6 10
15 11 8 10 14 16 28 17 14 20 17 16 14 13 22 20 28
23 23 20 27 18 18 20 14 18 18 16 11 28 11 19 17 17
16 16 18 15 14 20 10 10 19 19 11 13 13 16 9 10 6
9 8 10 14 17 25 20 18 20 20 17 15 11 11 19 16 16
19 19 18 22 27 14 11 11 27 32 24 22 18 27 20 27 18
16 20 20 22 20 13 19 20 18 25 17 16 17 20 23 17 22
32 24 20 17 23 20 22 13 9 16 25 24 18 11 18 19 19
17 10 11 20 20 17 27 27 23 27 19 23 22 12 10 17 12
20 17 27 20 23 24 15 16 23 23 20 27 24 19 18 16 15
17 20 19 16 12 24 27 27 23 13 15 20 23 23 18 17 27
20 19 18 16 16 19 14 16 17 17 14 20 18 17 17 13 13
20 19 24 17 14 8 18 14 18 24 23 23 19 11 12 14 9
11 23 18 23 20 22 20 20 16 14 18 27 15 10 11 16 10
9 11 18 11 11 11 7 8 9 9 8 9 16 20 19 27 14
16 17 20 27 20 22 15 16 20 16 14 11 17 16 19 14 12
18 19 22 20 17 18 22 19 12 19 13 10 8 28 20 19 17
14 12 19 16 16 22 25 25 23 16 14 14 14 14 14 13 16