S03036-01_P19
Seqid S03036-01_P19
Sequence >S03036-01_P19.phd
NNNNNNNNNNNNNNNNNNGNNCNCNNNNNAANAAGGCNNANTCGNGCGGCCAATCGGCCG
AATTTGACGTGCATACTACTACAGTAAAAAAGAAAGTTATTTGAGAGCAGCACTTTGTTT
ACTACACAGAACATTAACCAAAAAAACATGCATCAGCAACACTCCAAATCAGAGAACAAA
CCACAACAGCAAAGGAAAAAATTCGAAGGCCCTAAAAGAGAAGCTATTCTGGATTTAGCG
AAGTATAAAGATTCTAAAATTCGCGTCAAATTAATGGGTGGTAAATTAGTTATAGGTGTC
CTAAAAGGCTATGATCAACTGATGAACTTGGTGCTTGATGATACAGTAGAATATATGTCT
AATCCTGATGATGAAAACAACACTGAACTGATTTCTAAAAACGCAAGAAAGCTAGGTTTG
ACCGTCATAAGAGGTACTATTTTGGTCTCTTTAAGTTCCGCCGAAGGTTCTGANGTAATA
TANANGCAAAAATAGGTTTAATAATATANTCTCATATAAACTCCCTTCCTTACANNTGAA
NACCAGNTNAAAACANAGTTAAGAAGAATCGGGGGCGGACCNGGTTGAGTAANACACCAG
GAGTGGCGGGCGTAAGGGGAGGCGGGAGGAAGCCANTNACGCCCACAGGNGAAATGGAGG
GGCTAGNGGGTGTAACGAAGAGACTNATATNTGAAGTANTGATAGAANCATCTACAAAGT
AAGAGGGAAAAAGNAGNGANCGACAAGNATAGNNGGGAGGGAGTCAGNGTNAATGGGCGN
GGTGTGAGNTGTTAGAAAATNTTGTGCTTATTGGGGNGANAATTGATGANANGNGGNNAN
ACTGTGCCGAGCNAGAAGTNNATGNGNNCTTNTGGNGTTGANGN
Quality >S03036-01_P19.phd
5 2 3 3 3 3 3 2 3 2 4 5 6 5 3 3 4
5 9 6 6 8 7 10 5 5 3 3 5 10 13 5 26 9
18 19 8 5 3 8 7 10 8 20 7 16 10 30 29 13 10
8 12 26 33 34 41 29 35 27 26 15 25 47 34 29 21 23
31 35 51 41 31 43 28 41 35 31 41 37 42 46 34 30 30
49 40 40 46 49 49 37 50 49 49 42 50 42 49 42 52 52
49 49 37 49 46 54 35 32 46 38 44 49 54 43 43 50 49
42 37 42 42 43 43 29 50 42 50 50 44 37 44 44 44 44
43 46 44 50 42 32 17 20 44 49 60 42 49 60 47 49 60
52 50 54 57 60 46 45 47 47 63 60 63 35 58 63 57 52
47 60 63 35 63 63 60 47 58 63 63 63 42 57 60 52 58
44 52 63 46 63 63 52 63 52 53 53 63 63 63 47 63 52
47 52 63 35 63 42 63 63 52 47 63 63 63 39 53 18 52
63 42 52 52 46 47 63 60 46 60 53 52 41 60 63 39 47
52 52 52 52 41 52 42 45 45 57 48 48 34 35 48 53 42
36 57 60 60 60 53 47 33 52 53 47 46 19 52 57 45 57
36 53 60 53 63 63 28 57 63 21 47 63 63 47 63 47 46
47 63 46 41 41 47 63 30 57 31 47 63 29 46 52 57 57
34 63 14 46 41 41 41 47 18 44 25 53 37 42 46 37 32
60 42 58 41 46 63 47 57 46 60 25 41 53 52 28 28 47
39 22 42 42 19 46 46 42 42 57 53 30 35 35 35 42 52
42 35 32 26 53 43 48 52 46 60 52 35 52 46 21 52 47
52 60 52 47 25 52 52 47 52 52 46 46 46 42 60 34 17
28 60 60 47 42 35 57 60 57 57 57 23 44 34 52 42 35
21 43 57 44 44 35 44 57 22 43 32 28 25 22 52 42 29
35 32 47 21 29 28 52 35 44 19 42 39 35 28 42 44 42
25 35 35 23 29 16 22 16 33 35 28 42 29 26 25 21 26
26 35 47 16 23 15 10 15 9 23 19 19 24 21 7 12 10
10 9 9 42 10 9 7 12 6 12 32 23 41 35 41 39 20
20 16 14 9 32 12 11 46 22 12 11 16 16 16 10 6 16
10 13 20 19 22 16 16 10 17 23 13 21 16 26 35 25 32
16 19 11 16 15 13 9 7 6 13 11 11 9 6 18 13 9
9 10 6 11 7 11 16 13 10 9 9 7 11 12 10 14 16
17 8 9 24 12 15 9 9 10 18 11 10 20 19 11 14 12
10 10 9 7 17 17 15 16 14 13 14 8 11 8 6 10 8
12 11 11 16 12 9 10 11 11 14 14 13 20 14 11 9 22
11 11 11 14 19 24 8 9 10 14 11 13 11 17 17 11 21
10 13 13 19 14 11 7 8 6 9 11 14 9 10 15 14 13
14 8 13 7 11 18 11 10 12 11 24 11 11 15 11 11 11
10 10 9 6 9 14 9 10 16 19 9 11 11 14 8 11 9
11 10 16 10 9 6 10 10 16 11 7 10 10 9 10 10 9
12 7 9 12 11 9 9 11 10 9 6 9 9 10 12 8 14
10 9 8 11 11 9 9 10 13 14 10 8 8 9 9 11 11
10 11 7 11 9 7 11 10 6 10 14 10 10 11 11 10 6
9 11 8 9 6 6 9 11 9 9 9 9 8 11 9 10 9
10 9 6 14 11 7 10 8 12 10 9 10 11 9 7 10 16
11 12 11 14 10 9 6 9 9 9 11 19 10 11 14 8 9
8 6 11 10 10 8 11 9 8 10 9 10 9 9 9 14 9
7 9 10 7 8 11 10 8 9 9 8 11 11 6 10 6 10
6 11 9 7 6 9 6 9 11 11 9 9 11 9 14 10 8
8 10 6 10 11 9 8 11 9 6 6 15 10 9 6 14 6
6 9 9 10 7 9 11 9 6 14 8 10 9 11 6 8 6