S03036-01_P20
Seqid S03036-01_P20
Sequence >S03036-01_P20.phd
GGNTNNNNTTTTTNTNGNNCCNNNNANNNNNNNTNNNGACGGCNNGGTCGNNCGANTTGA
ACGACACAGGAGAGAACTAGCGCAAAAGATGGCAGAGATAAAGCATTATCAATTCAATGT
CGTCATGACCTGCTCGGGATGTTCTGGTGCAGTCAATAAAGTTTTGACGAAATTAGAACC
AGACGTTTCCAAAATAGATATATCCCTTGAAAAGCAATTAGTAGATGTATATACTACACT
TCCTTACGATTTTATTTTAGAAAAGATTAAGAAAACCGGAAAGGAAGTTAAATCCGGNAA
ACAATTGTGAATGANAGTGAAGAGAAAAGTTTTTTACNCTATNTTNTATTGTAGCTAGNT
AAGAGAGTGATANGNGGGCNGTCGATNTGGTTACGNGNANGNGGAAGGAGGGAGCTGCAG
TNTGGGGNGCCCTAAAAGCGGAATTGTGNGGATNATNTCGAGGCNTGGATCAAAAGTGTG
TGGGGGAGAAGAAGAGACGAANTGGGAAANAAAGGGGCAAGCAACTACCCATGCGTAAGA
ATAGAAGAAAGGGGAGAAGGGGGGGGGGAGAGTGGATAGGAGGNCAAAGGGAAGGGCGGA
AGAGATNGGTGGGGTGGATTGGAGGGGGAATAGGNTAAATNGAGAAAAAAGACATCCAAA
AAATAACTNCGCTAGGGAGGNAAGGGAGNGGGAGAAAGGNNNTAGANATACTTAGCAGCN
ACCGNNNGGGGGCGGGTGGANGNGAGGNGAGGGCCGANNGAGAGGNGANACGAAGAGANN
NCAGANGTNNAGANAANNCCNGCNNNNNGNCGCGCGNGNGNNGAGAGAGCNGCTGTAGAG
AGGNNCGCGNNAGCANANACNNGNN
Quality >S03036-01_P20.phd
25 10 7 8 6 6 5 5 10 8 8 22 17 6 10 6 13
5 7 8 9 3 7 5 5 9 5 6 7 5 7 7 6 9
7 6 7 13 9 9 17 14 10 7 6 12 10 15 11 9 7
6 20 14 13 7 18 35 20 9 9 15 13 13 22 13 31 9
9 14 16 13 23 19 26 22 26 32 14 18 22 32 28 32 47
53 45 34 42 32 53 42 57 53 28 53 26 36 32 24 23 22
24 35 23 37 45 31 47 26 9 19 35 46 41 12 40 45 53
41 42 33 34 27 13 40 32 15 21 23 27 53 24 34 31 37
53 44 33 33 53 53 60 60 53 60 52 60 53 57 52 57 53
53 57 60 53 53 60 57 53 53 57 53 53 53 52 52 45 57
53 53 52 52 53 53 60 53 53 52 32 53 52 57 52 60 57
57 60 52 45 48 48 48 52 46 57 52 57 47 60 57 57 57
53 43 60 52 52 52 48 48 48 53 52 52 52 54 52 52 53
43 53 46 57 53 53 53 47 53 53 52 34 37 28 37 53 23
35 38 30 27 31 27 27 18 18 13 34 38 31 31 39 38 53
60 53 35 28 27 42 42 42 13 8 19 33 53 41 53 14 23
13 12 19 35 37 19 18 14 14 13 13 23 12 12 11 35 35
30 16 18 30 14 13 9 14 6 9 13 19 18 9 16 19 37
46 42 46 30 19 14 10 12 6 10 30 18 18 19 19 9 35
12 10 14 9 11 9 12 16 12 16 20 9 13 16 6 14 12
11 8 7 11 11 7 11 9 9 20 14 12 13 11 18 9 9
9 6 10 12 18 14 9 10 14 8 11 24 24 12 9 6 9
6 9 9 11 9 6 10 11 9 10 9 8 6 9 10 9 10
11 9 10 14 7 10 7 12 6 10 7 14 10 10 9 9 11
14 11 10 9 14 9 9 11 10 12 11 9 8 7 11 9 10
9 10 6 10 14 9 11 12 11 9 9 11 14 10 9 17 13
11 10 9 13 10 11 6 8 11 9 11 6 10 11 6 8 11
11 10 11 8 8 7 14 13 10 10 11 11 14 10 9 11 11
12 11 10 11 15 16 11 10 11 12 10 10 10 9 10 14 16
9 10 9 9 10 11 11 12 6 10 13 18 11 9 11 10 7
13 14 18 9 11 10 10 8 9 9 14 9 13 11 17 20 17
10 10 9 11 11 11 11 11 11 11 11 12 13 12 11 14 14
9 9 10 14 10 11 9 12 9 9 11 10 14 10 12 18 16
17 10 13 10 8 14 11 15 13 11 10 9 10 9 10 13 11
15 14 11 8 9 7 11 14 11 10 11 21 13 13 10 16 11
15 11 20 18 15 10 9 11 9 18 9 7 12 12 12 10 9
10 23 18 13 18 17 22 23 16 12 10 14 9 11 14 9 19
20 10 9 14 10 6 11 21 17 14 8 7 10 9 15 16 10
11 10 14 14 15 12 11 14 8 11 14 18 20 23 17 17 25
14 13 14 17 11 6 16 13 12 12 15 8 14 19 11 8 10
7 10 8 9 14 15 8 9 6 9 12 18 14 16 10 11 9
11 14 7 6 6 8 22 27 15 6 9 8 12 12 14 15 15
20 13 13 14 11 6 10 10 9 12 7 6 6 10 10 11 12
13 13 11 11 15 12 13 10 8 5 8 5 9 8 11 12 7
24 13 10 13 12 11 9 14 8 6 5 9 11 14 17 8 10
7 12 9 6 12 15 24 27 11 11 24 21 20 7 6 7 10
10 15 9 5 13 8 6 6 10 13 10 7 12 12 7 7 11
9 6 10 11 6 5 3 3 3 8 7 11 11 9 9 9 11
7 13 7 17 6 7 18 14 15 11 21 14 19 10 7 14 9
15 13 13 12 15 11 14 14 17 12 7 6 10 10 11 11 7
7 10 9 11 9 7 10 6 8 10 6 6 9 6 7