S03036-01_B15
Seqid S03036-01_B15
Sequence >S03036-01_B15.phd
NNNNNNNNNNNTNNNNNGGCCCCNNNNANANNGNGATTGNNNGCCNNTCGGCCGAATTGA
CTTTTTACCTCCTTCTACTACACTTTCGACAAAATTTCTTCCTTTGCTATTTTTGAGAGG
CAAGCAACAAGAACATAAAAAATTGTTTTTGCTACATTGGTTTCACATAACATATTTCAA
CAAACATGCCATCAAATTTGAATATAGTGAAGGTTACAAAACCACAAGAAGAAAATAAGA
ATATTTTACACAAAAACACGAATGAACCCAATGAAATGGAACAATCGCAGACACAAGAAG
CAGTTACAGAAAATTTTACCGAAAACAGTAATCTCAGTGCAAATGAACATGCAGCTAGGA
GGGGTAGATTAAATTTGAAAACAGTTGATCACATAGAAACTTATCCAATAGTGCAAGAAA
CAGAAGAGATTGCAAAAAAGATTGCTCTAACGAGAATTATTTTAGCACAAACAAAGCCTA
GAATCGATAAAGTGGTAGTGTCACGTCCCGTTCANGCCGTATCACCAGTGGTCAATTTTT
TTGACAAGATGGCCAAATCGACTTTAAGTACAAGTAGAAAGGTGGGGGGAGGGAGGGGCA
GTTTTGTTATTATTTTTTTATATGTATGGGAGAAAAAAACAGAGGGAGCGCGGACTTTTA
AAAGTGAGTAGTAGGAAAAAAAAAAAAAAAAAACACCCCCAACAACACCTCCTGGAGGGG
GGGAGNAGGGGGGGGCAANAAATTNATATTTTTTTTATGTAAACNGGAGAAGAAAAANNN
AAGAGAGGAGACTTTCNTTTATTTTTNCATTATAAAAAGGAAGNAGAAACCCCCCCCCCC
CNCCTNCGNNCGGCGGGGGCGGGNAAGGGGGGGGGGGGGNNNANTTTTTTTTTNN
Quality >S03036-01_B15.phd
6 4 2 2 3 4 3 3 2 2 6 8 7 5 5 5 7
10 10 10 9 10 9 7 6 5 6 8 7 9 7 7 11 7
20 20 12 16 15 6 7 7 18 15 11 7 5 24 28 39 30
31 37 31 29 15 31 28 23 13 14 30 33 34 23 20 20 21
34 41 32 31 33 27 28 21 33 21 21 24 23 20 32 35 37
32 32 17 29 27 30 33 39 30 33 35 26 36 27 24 36 39
42 42 42 42 26 21 21 22 27 27 21 21 35 60 44 50 44
37 23 40 35 42 44 35 47 60 42 42 47 47 42 47 42 47
47 60 60 52 60 52 52 60 57 47 57 60 60 57 42 35 25
42 46 35 52 52 52 52 44 57 47 52 44 47 31 35 39 42
42 47 52 52 57 60 52 46 47 42 52 44 57 57 57 52 60
52 35 32 35 60 40 35 46 63 58 60 57 58 63 63 57 60
57 63 58 57 41 47 60 52 45 35 47 57 60 39 42 60 40
35 43 21 35 12 29 47 57 60 60 52 35 34 35 35 35 47
35 35 20 29 29 35 47 47 52 57 57 52 57 52 60 58 60
57 52 44 47 34 47 43 40 47 43 40 42 35 35 17 57 60
60 35 42 44 39 46 43 41 41 34 42 44 47 42 42 57 52
46 52 28 34 54 22 47 43 47 47 47 42 47 44 40 46 35
32 24 60 44 47 47 44 26 41 21 41 35 26 19 27 44 41
41 47 35 42 47 47 47 63 35 35 28 33 31 35 47 47 38
26 33 23 38 38 33 16 27 22 32 33 47 22 32 43 37 35
43 42 37 18 41 20 42 27 60 47 60 28 60 47 50 60 60
58 58 44 38 57 53 50 42 34 54 50 54 54 54 54 44 36
42 39 49 35 42 50 49 54 42 38 49 42 39 35 32 25 57
39 54 34 42 54 39 31 57 43 46 54 54 34 50 54 59 59
59 54 42 41 19 50 54 42 17 50 49 49 52 50 39 44 22
57 52 30 54 42 50 22 39 36 22 54 43 42 51 36 49 54
31 54 54 54 46 36 42 30 36 19 28 30 42 11 23 19 35
42 54 20 32 27 35 35 39 39 36 43 34 36 43 42 59 34
50 38 20 28 27 22 39 22 22 35 33 33 44 35 24 33 42
42 44 20 13 7 12 31 31 22 42 23 10 28 39 22 42 16
44 42 32 42 35 24 42 17 16 40 31 26 23 24 35 11 22
12 44 28 23 44 13 31 35 20 32 20 14 16 20 29 13 33
27 30 33 34 19 19 39 31 15 24 25 16 16 20 14 10 15
14 14 11 11 10 11 13 15 32 27 31 11 27 23 9 10 8
11 17 32 11 19 13 19 24 27 11 11 11 14 14 21 24 15
35 32 15 26 13 15 26 11 11 10 8 10 9 11 12 14 16
18 18 14 12 11 11 10 11 15 20 14 14 32 18 32 15 14
17 18 20 18 11 8 11 13 10 11 15 9 14 14 15 17 24
14 14 24 13 8 15 11 11 11 14 9 10 18 11 11 22 8
15 20 40 17 33 18 12 19 25 14 14 11 11 14 27 28 15
10 9 14 10 17 14 10 10 18 15 13 20 17 13 11 12 11
11 12 18 27 14 15 25 22 32 8 11 6 10 23 17 14 11
9 11 9 10 9 8 14 7 8 11 9 14 10 6 9 11 12
18 13 15 14 13 15 9 17 11 10 11 10 13 12 25 11 6
10 9 10 11 10 11 9 13 15 19 19 16 7 6 6 9 10
15 14 15 13 13 10 12 16 11 8 14 15 16 14 7 11 14
14 10 17 13 12 11 10 6 9 8 23 9 10 11 9 23 21
11 13 13 13 10 10 9 7 11 16 17 13 10 9 9 13 12
21 21 19 14 9 11 17 11 6 9 9 8 6 10 8 7 6
11 26 13 13 11 11 13 15 22 12 14 14 19 7 9 9 10
10 34 11 28 10 10 9 10 9 16 12 19 6 6 6 8 7
9 9 12 10 9 9 10 11 11 6 6