S03036-01_P22
Seqid S03036-01_P22
Sequence >S03036-01_P22.phd
NNNNNNNNNNNNNNNGGNNNNANNNNNNGGCGATTGGCGGCCAAATCGGCCGAATTGAAG
GATAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAATTAAAAATGCAATTCTC
TACCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCCGCTTCTAACATTACCAC
TGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTTCCTGTGAGGACCACGT
TTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCGTCACCGTAAATGACGT
TATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAGCACCAAAGAATACCAC
TTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAAAGCCAACTGAAAAGCC
AACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTGGTGCCGCTGTTAAGGC
TTTGCCAGCTGCCGGTGCTTTGTTGGCTGGTGCTGCCGCTTTATTGTTGTAATTTACTCA
ACCTTTTCTTTAATATATTTTTAGAAAAATGGTNNANTACTTTTCCGTCAATACAGCTTC
CACNAAATCCTTNTATTTCAATTNATAAGAATANNCTGGTNNTTCNTATTCTAATNCTAG
GNNCAACACTCCANNNNTNAANNNTATGANNNNNANTAATATAAAAGTTAANATNNATTA
GGNNNNGGGCAAANNNNNGTTTGNNTGTANNCNNNTTGCATNGANNTTNTNAAAANCTAA
GANGGGNTGTTNGAGNNAGGNGNGANAAAANANGGANATTCTTGACCANCAATNCTGGGA
NGGNGGAGN
Quality >S03036-01_P22.phd
4 4 3 2 3 3 4 3 3 3 4 5 7 7 5 17 13
7 5 7 7 10 5 7 5 7 6 6 15 32 17 26 28 13
22 42 18 18 41 25 10 14 10 11 13 28 37 42 30 32 40
35 26 18 30 36 35 21 18 35 41 18 9 32 38 32 30 30
38 30 32 29 36 41 50 50 42 52 42 43 39 31 32 49 31
42 54 46 28 19 28 37 41 41 35 35 46 40 38 38 16 18
15 21 18 19 17 19 24 22 23 35 29 24 27 33 43 39 35
39 33 42 50 49 49 46 43 42 43 44 45 47 45 44 53 49
49 49 42 43 49 44 46 50 51 51 51 51 53 50 45 53 51
53 51 50 50 44 49 49 54 54 49 54 54 49 34 41 42 42
40 49 42 51 50 49 49 39 40 50 43 42 49 42 49 45 45
42 57 50 49 50 50 50 57 57 47 53 46 50 54 50 49 43
39 28 45 49 49 43 42 50 54 49 37 42 42 42 49 49 43
50 49 49 54 43 43 54 42 53 42 42 49 35 30 35 42 42
50 54 46 46 54 50 50 49 57 53 53 54 50 49 50 57 53
53 49 50 49 45 47 42 54 54 51 53 51 51 53 43 51 51
50 50 50 50 51 53 51 50 49 42 43 51 54 49 37 46 49
54 52 49 49 49 49 47 50 38 54 54 49 46 49 54 54 50
49 46 49 53 51 57 54 46 42 51 54 49 51 49 53 43 40
51 49 46 46 30 49 51 51 43 42 30 49 46 46 35 45 40
50 39 41 49 54 42 35 54 43 46 46 40 42 42 43 49 43
43 54 54 49 53 49 49 46 50 31 49 54 50 37 46 25 49
40 46 49 53 49 49 49 49 46 45 25 40 37 46 49 52 47
43 53 42 49 49 35 49 46 52 49 50 49 49 49 43 36 47
30 52 52 52 53 43 42 46 49 42 30 40 24 49 36 40 40
43 46 43 32 49 49 53 28 49 35 46 46 46 43 52 35 49
32 32 49 52 38 49 49 33 49 37 35 39 35 28 49 35 37
46 30 49 46 49 49 42 49 35 49 43 49 49 52 33 49 30
31 21 50 28 46 38 49 43 28 49 35 43 46 49 52 46 45
40 40 29 49 46 35 49 49 49 30 40 35 40 35 52 49 51
36 49 37 46 42 29 31 25 37 37 43 46 27 13 35 41 11
31 49 16 41 25 23 21 16 23 28 35 27 14 21 29 29 31
42 28 46 21 30 46 31 27 15 27 27 30 37 23 20 21 26
40 29 17 20 14 23 35 22 17 14 17 11 7 4 11 5 10
19 22 26 49 41 33 26 25 13 13 28 19 28 28 23 35 13
31 29 28 26 19 22 27 12 5 11 23 26 11 13 22 16 12
6 9 18 9 16 14 13 19 17 12 22 7 28 16 25 16 9
10 20 9 13 6 7 10 8 16 16 8 6 6 10 25 19 5
17 9 10 23 19 9 28 10 8 7 9 15 26 18 9 5 6
13 27 23 20 20 16 16 9 15 9 6 5 7 6 14 6 8
9 5 5 5 9 11 13 9 8 6 6 6 7 7 12 7 18
26 18 17 26 21 11 18 20 16 11 11 13 11 10 7 10 10
7 6 8 9 17 19 15 8 7 5 5 6 9 9 11 9 10
10 8 6 6 6 6 6 9 11 9 9 12 6 6 9 10 16
11 6 6 9 6 6 7 16 14 9 12 15 17 6 26 12 6
6 9 10 7 9 6 12 9 13 16 7 9 17 26 12 9 10
7 9 10 9 7 8 11 9 10 7 8 10 14 6 6 8 10
9 6 8 6 12 17 6 12 12 13 17 7 10 6 8 9 9
7 10 9 12 8 17 12 9 8 8 9 10 7 9 13 16 11
7 11 11 10 14 11 9 6 14 11 6 9 18 16 9 7