S03036-02_A02
Seqid S03036-02_A02
Sequence >S03036-02_A02.phd
NNNNNNNNNNNNNNNNNNNNGNNCNNNNNNNNNNAGGGNGATTGGCGGCCAAATCGGCCG
AATTGAGAGCATGTATTTAATCCTCCCCTCAATATTAATGTGTAGTGGGTACATAAACAA
TTAAGGGGACCAAACATATAACCAGAGCTAAGGTATTACAAAGAAAAGAAAAAAAAAAAT
TAAGGTTACCAGGTACAACATAAATAAAATTCAAGGAATTACTTTTTGTCGTGCAGCTAC
CATTTTACTTTGAGTTGTATTTTGTTCAAGCTTGTATATGGCTGTTTCTAATATATGGCA
ATCGTACTCTTCCTCCAATTTACATTGGATTTATCCTCTGTATACCAATAACTGTTCACA
AAATGTAAAGCCATCATTTACAGCAGAAATATTATTGAAAAGAAGATGTAATGATATTCA
AGATATACTTAATGACAGGATGATTGAATTGTTGCTACAGGGCGCGTGTGACCCAAATAA
GCAGCAGAATTACCTTCAGGGGATGAGTCCAAGTAGGAAGAAGAAAACCCACGTTAAGAA
ATTTTTGAAAAAGCAAAAAAAATCAAGGAAACCAATCACTCTGGAGCATGGTTGCTTGTC
AGGACCCGTGACTCTACGTTTCGGAAATTTTGCAGGAATCANAGATTTGAGAGGTACCAG
GTGCCCGCTCCACGGCATAAAACATGGTGTCCATCCAAAACCCGGGGAGAAGTGTGCATG
TCAACAAGCTACCCTCTTTCCAGTCCACTAGCTCGNNNTTAGTTGTGAACAGTCTGCTGT
NNTTGGTCGCGCTGCCTCCTCCACANAGGGTCTATGACAGTATAGCCGATGAGTTTTCAT
CCCTATAATTTTAAACACANANGAAACAATTCCCNAAAAAAACTGTGNANANNAC
Quality >S03036-02_A02.phd
3 3 3 3 2 2 3 3 3 4 4 4 3 4 6 2 3
5 3 6 9 7 5 8 6 7 3 3 3 3 5 3 5 5
12 8 15 14 6 19 19 15 31 29 11 10 21 19 15 17 19
14 25 34 41 40 26 35 42 43 32 22 37 50 38 23 26 38
44 34 36 31 49 34 35 38 51 42 37 50 43 46 40 49 49
49 49 43 43 43 43 42 42 52 43 42 49 46 43 51 50 50
46 50 50 50 54 54 50 54 29 42 54 54 50 54 54 52 50
54 54 45 50 49 49 51 54 54 34 24 50 50 60 54 54 50
50 58 49 44 60 46 44 44 47 45 47 60 44 50 49 47 45
49 54 45 63 63 60 57 57 60 63 63 63 63 63 63 63 63
63 63 63 63 63 60 60 60 58 58 58 57 57 57 63 57 52
57 52 52 52 60 63 52 57 63 57 60 63 63 63 63 63 63
63 63 63 63 63 63 63 58 58 57 60 63 58 58 53 53 60
53 60 60 60 60 60 63 60 58 59 59 63 60 57 60 52 52
60 58 52 52 57 60 60 48 30 28 30 30 43 43 48 57 60
60 63 60 60 63 63 63 58 63 58 58 58 59 53 59 57 57
63 63 63 58 63 60 63 63 63 54 60 63 58 60 63 63 58
58 63 63 63 63 60 58 63 63 60 63 60 63 63 59 58 63
63 58 63 60 57 60 60 57 60 53 54 57 60 63 63 60 58
57 58 58 63 57 63 58 58 57 57 63 63 60 58 59 57 60
59 60 60 60 63 58 58 60 58 57 60 57 63 63 57 57 54
57 57 52 57 60 57 52 57 60 57 60 57 54 57 57 60 58
58 60 58 63 63 59 60 54 59 58 63 57 63 60 52 52 57
52 63 63 63 63 63 58 58 60 60 60 63 60 60 52 48 63
57 63 58 52 63 58 52 58 51 63 58 54 63 63 63 54 58
54 59 51 60 63 58 63 63 58 57 60 59 58 63 41 44 63
41 42 60 58 58 60 50 63 63 54 57 50 50 54 54 60 54
59 58 60 54 54 58 63 49 58 60 54 44 44 46 44 46 54
57 54 54 54 54 59 59 54 54 54 59 57 54 50 54 54 54
46 50 54 50 54 50 50 47 49 45 23 49 57 39 54 50 51
49 51 54 54 54 50 54 54 54 43 49 49 41 49 39 40 42
39 46 38 46 46 43 54 54 54 57 42 57 49 34 32 50 54
54 54 43 54 57 54 54 54 38 50 43 50 49 54 49 50 54
54 54 54 46 46 54 57 47 45 49 36 46 49 54 46 49 46
32 46 39 35 35 27 35 32 37 35 31 49 30 32 46 46 46
49 54 52 40 38 32 33 49 31 35 49 46 29 35 36 32 41
41 37 36 35 43 28 35 33 37 37 41 33 36 43 43 35 36
43 43 42 35 46 35 52 43 21 28 36 30 6 42 32 28 28
49 43 30 46 35 49 27 31 30 32 35 34 32 19 34 20 28
26 46 35 26 31 31 32 42 31 19 27 28 20 35 33 42 37
42 44 16 32 46 50 42 21 32 16 28 32 23 37 24 33 30
30 25 37 36 36 32 34 35 27 24 16 9 19 13 15 32 28
32 22 22 15 32 27 31 20 20 17 11 11 17 20 32 31 18
26 25 25 20 29 19 34 25 16 10 13 10 20 12 28 20 24
18 17 19 9 14 17 11 7 7 7 12 9 9 13 12 9 16
11 18 15 13 12 21 18 16 17 22 20 18 21 28 12 7 7
11 25 17 24 15 15 18 18 10 12 15 9 10 17 15 11 19
15 10 31 22 17 20 7 14 27 20 24 17 14 20 12 19 28
20 11 12 16 10 13 18 18 11 17 16 14 31 14 12 17 16
15 18 18 21 14 17 16 12 19 23 16 10 9 15 8 20 21
19 28 28 32 31 18 10 11 10 6 9 6 10 30 19 33 17
14 21 20 19 16 18 12 6 9 12 13 10 9 15 23 19 13
11 9 8 5 10 6 8 6 6 12 9