S03036-02_A04
Seqid S03036-02_A04
Sequence >S03036-02_A04.phd
NNNNNCCNNNNGNNTNGGCCCGCNCNNANANGGNGATTGNGCGGCCAAATCGGCCGAATT
GAGGACAGGCCAATTGGATAAATTTTGCAAAGATCAAACAGTAACACAAATTTTAGCAAC
CTAAACCCCCCTCATAAACGAAGACAAAAGTGCTCCTCCTCAAGTCAAATTTGTCTTTCT
TTTCTTTCATTTTTTAGTCTGTTGTTATCCAATTTATACTGAATCTTTGAGAGAAAACAA
AAATAAAAAAAAGAATGGTTTTGCCAAGACTATATACTGCTACATCCCGTGCTGCTTTCA
AAGCAGCCAAACAATCCGCTCCGCTTCTATCCACTTCGTGGAAAAGATGTATGGCCTCAG
CTGCTCAATCTACTCCAATCACCGGTAAAGTTACCGCTGTCATTGGTGCCATTGTTGACG
TTCATTTTGAACAATCAGAGTTGCCCGCTATTTTGAACGCTTTAGAGATNAAAACACCTC
AAGGTAAGGTGGTATTGGAAGTTGCTCAACATTTGGGTGAAAACACTGTCAGAACNATTG
CNAAGGATGGTACCGAAGGTTTGCTCCGTAGAGNGTAAGNTGAAGGAGGCGNNCTNANAG
GCCCGNGAGGATGGGAGGGGGGATAGGGGGGGGTATATGAAAGAACGTTGGAAAATGNNA
ACAGAAGGAGNANGCTATTCGGGAGGGAGGAGTNACAAANGGGAGTNAAGGNGNAATAAA
TGNNAGANNGATCATGGGAANGGCGGGGGAAGGTTACNATGGTTGGGAGGTNNAAGNTAT
AAAAACGGANTGGTNGNGGAGTGTAGTAGNNAGGGTTAGGGNTGGGAGAGANAGGANAAA
ATNGCGAGANAGAAGTTNNTGNNAGNGGGNACGGNANNGNGACATAN
Quality >S03036-02_A04.phd
7 7 5 5 6 9 8 6 6 5 6 8 7 7 11 6 10
12 10 20 9 17 10 7 9 6 5 8 6 10 7 22 19 6
26 31 19 23 17 6 17 9 27 20 9 21 11 8 14 27 28
36 22 18 31 31 27 12 28 29 34 16 16 29 18 13 28 42
43 33 30 32 32 36 43 49 35 27 18 49 43 35 30 35 35
41 41 43 34 32 43 54 42 32 42 35 39 42 44 29 39 36
39 39 42 36 39 35 35 42 42 60 35 27 31 42 50 44 44
47 47 52 46 47 47 52 60 60 60 60 52 52 52 52 52 52
57 60 52 57 60 52 52 48 54 60 57 60 57 57 57 63 52
52 57 57 52 57 57 53 57 60 52 48 48 57 52 57 60 57
60 60 60 57 57 60 60 52 54 60 60 60 52 57 60 57 58
52 52 57 60 60 63 63 52 63 63 63 63 57 63 57 57 63
63 58 63 57 57 52 52 57 60 60 52 57 57 52 57 57 63
63 63 63 63 60 60 58 63 53 63 57 57 57 60 48 52 57
46 47 47 47 35 36 35 47 47 46 60 60 60 60 63 63 58
52 63 63 57 63 60 63 63 52 52 52 58 58 63 52 58 57
58 57 57 57 58 63 63 63 63 63 60 57 60 60 60 60 63
52 63 60 60 63 54 60 60 63 52 52 59 60 60 57 52 57
57 52 46 58 58 57 52 60 60 57 60 53 53 53 57 63 60
57 60 57 60 57 57 60 57 52 42 52 60 57 60 57 47 63
58 52 52 60 60 60 52 46 53 57 60 52 63 63 42 57 57
57 60 57 57 57 60 57 52 52 52 43 48 57 52 57 57 60
60 52 52 63 57 52 60 54 60 57 57 52 60 57 57 52 57
60 52 52 60 57 47 52 57 60 52 57 52 60 57 52 42 57
39 40 46 47 48 60 44 60 57 52 37 48 60 60 35 42 57
60 60 57 52 60 57 42 39 47 40 43 18 34 52 47 41 40
48 40 40 52 52 52 47 40 42 47 52 57 52 48 30 26 35
45 47 36 24 20 27 10 9 10 13 6 8 16 29 39 45 24
26 35 47 36 29 18 32 60 13 23 24 19 11 13 47 32 9
8 10 23 42 41 19 10 22 35 10 9 9 30 35 28 42 31
18 24 35 45 45 42 42 27 34 33 22 45 24 18 22 11 9
9 8 17 34 16 22 35 12 6 14 18 18 37 9 6 15 10
23 19 31 25 40 41 15 22 34 26 13 34 35 12 26 11 10
10 18 10 14 10 12 20 11 10 12 9 11 6 10 9 11 9
15 6 10 9 14 11 17 11 9 11 8 11 19 6 7 11 9
7 8 6 9 8 8 10 14 18 9 6 9 10 10 10 14 10
25 32 19 16 19 10 17 12 11 9 11 10 10 11 15 21 18
15 11 11 10 11 11 14 10 10 15 13 11 12 13 9 10 11
11 8 9 9 13 16 14 13 14 14 9 6 6 11 9 8 10
10 11 9 9 12 14 9 6 10 7 9 9 11 12 10 9 8
13 17 11 13 21 12 16 11 11 11 9 10 10 7 10 10 14
11 11 7 9 9 9 10 16 9 6 12 9 9 9 6 11 7
11 11 11 19 22 8 9 9 6 6 11 32 12 7 6 9 8
8 14 10 11 10 19 9 10 10 6 11 10 11 9 11 10 11
9 9 10 9 9 11 11 10 11 6 14 10 9 11 10 10 9
11 8 14 9 10 14 6 6 8 9 9 6 11 9 11 9 9
11 10 9 8 8 8 13 6 9 9 13 15 7 9 6 13 20
9 9 11 10 16 12 9 10 11 11 6 6 10 19 10 10 9
9 8 9 11 11 7 11 9 9 11 9 11 9 8 10 6 9
8 10 12 6 11 9 8 14 11 6 10 10 8 9 11 10 6
14 10 9 9 10 8 9 6 5 8 8 5 6 14 8 6 11
9 8 7 10 9 10 11 7 9 5 7 11 6 14 8 9 8
11 14 5