S03036-02_A05
Seqid S03036-02_A05
Sequence >S03036-02_A05.phd
NNNNNNNNNNGGNGNNNNNNNNNAGGGCGATTGGCGGCCAATCGGCCGAATTGAACAAGG
AACTAAAAAATTGTTTTTGCTACATTGGTTTCACCTAACATATTTCGACAAACATGCCAT
CAAATTTGAATATAGTGAAGGTTACAAAACCACAAGAAGAAAATAAGAATATTTTACACA
AAAACACGAATGAACCCAATGAAATGGAACAATCGCAGACACAAGAAGCAGTTACAGAAA
ATTTTACCGAAAACAGTAATCTCAGTGCAAATGAACATGCAGCTAGGAGGGGTAGATTAA
ATTTGAAAACAGTTGATCACATAGAAACTTATCCAATAGTGCAAGAAACAGAAGAGATTG
CAAAAAAGATTGCTCTAACGAGAATTATTTTAGCACAAACAAAGCCTANAATCGATAAAG
TGGTAGTGTCACGTCCCGTTCAAGCCGTAGCACCAGTGNTGAATTTTTTNGACTAGATGG
NGNGGNNCGACTTTAAGTACAGTAGAACGCTNTGTNNCCTCTTNNNNAGNGAAAAGGACT
AAAGGGAGTAGGTGAGNGAAATGGCANTTTCGNAAANNTTTGTANANAAACCCNGGTANC
NCTCCACGGGGAACCGGCGGAGGGGAAATGGGAAACCGTNTTGNNTATGAAGTCCAGGCA
TAGCCAAANGGGGAAGTTGAAGNGCGCGGGTGAACGGANTCNNNNACAAAAAACAAGAGA
AGAGGGACCATAAGTTTGCTGACGTCGTAGAAGGGGGTNAAGGAGAGGAAAAGGAGGGCA
TGNTTTTAGGTGGNGGGNGGGTCGANGAGGAGAAGNCCGGGGAGNNGCNGGACATANATG
GGNNNAGAGNAANTNNGGNNGAGGAAAAATCCATAANCCACGGCNNNNGGAAGGGGCCGN
NGGGGGCATNNTANTGNAGAGNAGAN
Quality >S03036-02_A05.phd
7 7 2 3 4 5 5 5 7 7 8 8 7 8 5 5 5
7 5 5 5 5 7 8 8 14 32 10 22 22 12 33 23 21
15 30 26 27 12 9 9 21 32 18 23 19 25 28 32 21 35
26 22 9 9 12 9 13 23 20 34 11 12 9 22 31 22 28
28 46 17 35 33 32 29 31 46 46 46 28 11 10 24 10 26
41 39 17 32 39 35 32 11 39 9 19 10 15 33 11 16 18
29 33 13 14 9 23 28 11 11 14 11 10 18 34 19 16 13
34 24 25 32 32 41 53 41 45 37 35 46 35 36 33 34 46
52 52 60 45 52 60 60 53 57 46 36 41 42 47 53 46 52
52 53 23 25 23 34 45 23 53 60 46 46 41 42 52 53 53
60 52 60 60 42 53 53 46 52 46 47 42 53 53 57 36 46
47 53 47 46 57 52 52 54 57 57 53 57 57 57 45 39 39
53 52 57 52 60 60 45 46 57 57 60 53 47 33 48 53 34
45 9 18 23 28 19 23 19 47 45 47 35 27 42 23 30 45
47 20 35 28 39 45 39 53 52 57 57 53 37 30 45 57 57
52 52 52 57 57 57 52 60 60 45 46 57 46 46 46 46 52
60 47 34 46 57 52 57 57 40 43 43 52 52 58 63 52 52
57 57 52 46 52 52 57 52 52 41 52 52 47 60 35 20 20
32 35 24 40 26 34 42 57 52 37 17 40 35 35 48 43 26
34 40 30 18 36 37 60 19 37 39 34 16 35 28 20 14 15
19 27 20 42 47 22 14 15 36 14 28 14 28 46 57 30 16
11 20 44 20 17 28 35 24 32 52 46 48 32 53 57 23 42
41 35 37 24 39 28 38 32 53 26 26 53 32 28 35 19 16
20 19 53 39 37 22 34 19 16 24 41 46 33 16 20 18 16
7 16 44 20 23 11 21 24 23 33 14 19 11 14 9 8 14
10 13 44 53 40 17 16 11 17 23 23 24 27 10 24 18 29
12 11 11 18 12 9 9 11 17 16 14 31 28 18 10 10 7
13 8 9 18 28 35 20 24 24 9 6 9 16 15 9 9 9
19 9 18 11 6 10 7 10 9 6 6 10 11 14 11 12 23
13 19 29 13 19 17 24 14 18 9 11 23 24 10 19 10 28
9 6 10 12 10 6 6 13 9 9 33 22 33 6 6 6 6
9 9 6 9 10 10 14 11 9 9 8 10 11 26 18 14 10
10 14 14 12 11 32 20 28 21 14 23 9 6 10 14 14 11
18 9 13 9 11 6 9 9 9 10 11 6 21 9 12 6 6
10 16 9 12 11 10 6 9 7 11 9 9 10 8 9 6 13
9 11 12 6 9 7 8 11 12 14 10 16 12 13 30 34 10
14 13 18 18 17 14 13 9 9 9 11 9 9 10 16 9 14
24 12 20 11 11 14 10 10 10 10 6 11 21 14 6 6 12
14 12 16 14 18 13 13 14 11 10 13 12 16 22 18 20 16
11 9 11 10 10 7 9 11 11 15 21 15 12 11 10 10 8
9 19 6 10 9 20 14 12 9 11 9 13 12 18 11 21 21
18 7 9 11 7 6 6 6 15 10 12 8 11 9 11 12 9
34 18 11 14 10 13 24 10 13 13 8 9 9 16 20 9 11
10 11 10 10 9 13 10 11 11 15 13 11 9 14 8 11 10
8 23 11 12 9 16 8 9 14 9 5 8 10 9 9 16 15
10 14 14 9 9 9 11 14 9 11 10 9 9 10 9 20 10
6 14 12 11 9 18 9 11 17 21 14 6 11 9 9 6 10
9 9 9 9 14 11 7 11 9 8 12 9 11 9 9 11 6
11 11 16 13 14 15 9 11 6 7 13 9 6 12 10 9 11
10 11 8 6 14 12 12 9 10 7 6 7 9 9 12 10 6
8 15 6 8 6 6 11 9 6 7 10 9 11 9 14 19 14
9 23 10 12 12 11 9 9 11 6 11 11 10 8 22 9 10
6 7 6 6 10 10 9 10 11 10 10 14 11 8 8 6 6
11 8 9 9 14 10 11 10 6 6 9 8 6 8 9 6 9
9 9 13 6 11 9 11 6