S03036-02_A06
Seqid S03036-02_A06
Sequence >S03036-02_A06.phd
NNNNNNNNNNGCNNNTGNCGGCCAAATCGGCCGCGGCCATAAGGGCCAGCTTGAGTATTC
TATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATT
GTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGG
GTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGT
CGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTT
TGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGC
TGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGG
ATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGG
CCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGAC
GCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATTAAGATACCAGGCGTTTCCCCCTG
GGAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCT
TTTCTCCCTTCGGGAAGCNTGAGAGCTTTTNCATAGCATACACTTTAANNATCACAAGTC
GTGGTAAGNATTATGCTCAAAATTGGGNTGTTTTAAAAAACACAANATACNGCCNGAAGG
CGGGACCTAAANTGGAAAATAAATTTTTTAATAGAAATTGAAGAGACACCCCCCCACCCC
ACTGGACAAACCCATGGGAAA
Quality >S03036-02_A06.phd
3 2 2 3 3 3 4 6 2 7 25 9 7 7 6 16 15
6 12 35 27 23 19 16 25 16 25 42 35 22 32 46 42 36
46 33 40 29 11 46 36 46 47 52 26 33 28 20 52 52 52
52 51 50 49 52 32 24 52 51 49 52 52 52 43 44 35 42
42 40 50 52 49 49 49 49 52 51 50 52 52 52 53 42 42
57 54 49 46 43 50 49 52 57 57 51 50 49 50 57 57 57
57 57 57 57 59 57 53 57 57 57 59 57 57 57 59 54 44
53 53 51 53 57 57 59 57 57 57 57 53 54 59 50 57 59
59 59 57 44 59 57 57 57 57 57 54 57 57 57 57 57 59
59 59 57 59 57 49 54 63 59 59 63 63 63 63 59 63 60
63 63 63 63 57 63 63 63 63 63 63 63 63 51 63 54 63
63 63 63 63 63 63 63 58 60 63 51 49 63 50 63 63 60
60 54 63 63 51 49 43 43 63 50 50 57 54 60 50 63 50
51 46 43 41 43 63 63 63 63 63 63 63 63 63 54 50 44
58 63 63 63 63 63 63 63 50 44 63 63 63 63 58 58 60
63 44 50 54 60 57 63 58 60 49 50 58 49 63 50 57 57
51 50 57 57 45 44 50 42 57 50 54 54 54 50 49 53 53
53 44 29 54 31 50 39 54 50 42 51 51 50 44 50 49 50
44 38 43 46 47 39 50 50 49 54 49 49 46 57 50 50 50
49 42 57 43 59 43 50 54 50 32 39 43 49 50 34 54 54
54 42 57 54 50 43 50 57 43 50 53 40 46 50 49 51 54
50 57 42 54 50 43 38 57 59 59 50 43 54 59 59 59 59
38 54 54 59 54 50 50 42 50 54 54 42 59 59 38 57 30
50 57 38 59 59 59 46 45 44 54 59 54 54 43 35 50 26
43 46 54 49 57 32 54 46 37 39 30 47 42 30 38 54 54
37 37 49 31 53 49 57 57 28 49 54 35 43 42 59 59 50
43 22 47 23 54 54 54 23 50 21 45 27 27 46 27 59 59
54 22 54 17 54 38 28 57 42 52 41 50 40 34 54 52 54
54 50 23 54 22 49 36 46 54 59 59 35 46 54 38 54 46
32 59 59 46 42 43 30 46 35 46 40 21 42 27 54 43 49
32 33 42 39 54 54 50 54 43 50 33 19 50 21 30 43 59
44 44 44 32 42 59 59 43 43 42 42 42 31 42 59 44 29
26 16 27 32 27 34 28 50 9 44 38 50 39 26 21 44 59
50 34 44 46 30 39 27 36 31 42 44 29 32 28 31 9 44
47 35 44 29 35 35 35 23 21 31 14 24 16 18 32 33 34
27 33 47 35 25 29 19 20 13 13 32 11 46 46 24 31 20
29 47 35 24 33 29 32 32 24 46 46 27 19 20 32 26 16
28 16 31 46 33 46 35 34 17 26 34 41 27 16 41 23 17
24 19 17 32 23 13 12 26 18 40 11 10 10 10 14 41 38
11 9 11 14 27 32 32 18 15 47 46 11 16 14 13 6 11
10 13 12 9 22 13 27 36 14 9 6 11 21 18 15 14 10
10 11 27 19 14 21 14 10 11 14 11 6 6 19 20 14 11
23 14 20 18 10 9 13 10 10 10 19 17 14 10 6 11 11
11 14 9 10 12 20 11 17 17 11 10 18 13 37 14 18 7
8 14 19 11 13 11 11 20 9 9 18 11 13 20 17 15 10
7 9 15 11 18 7 10 18 8 7 11 13 11 10 11 14 10
15 12 17 17 22 9 22 14 9 7 11 11 16 23 17 16 19
11 17 16 13 12 14 16 16 16 17 11 11 9 10 11 14 11
14 11 11 13 13 17 16 23 15 19 16 13 10 11 16 28 11
9 14 20 25 19 19 28 27 20 18 17 16 11 12 14 12 10
11 13 11 15 17 19 16 19 9 11 8