S03036-02_A07
Seqid S03036-02_A07
Sequence >S03036-02_A07.phd
NNNNNNNNNNTTNTNCNGGGCNNNNCANNANANNGNGATTGNGCGGNGNNNTCGGCCGAA
TTCCCATGGGGATCCGATGAACAAGAACATAAAAAATTGTTTTTGCTACATTGGTTTCAC
ATAACATATTTCAACAAACATGCCATCAAATTTGAATATAGTGAAGGTTACAAAACCACA
AGAAGAAAATAAGAATATTTTACACAAAAACACGAATGAACCCAATGAAATGGAACAATC
GCAGACACAAGAAGCAGTTACAGAAAATTTTACCGAAAACAGTAATCTCAGTGCAAATGA
ACATGCAGCTAGGAGGGGTAGATTAAATTTGAAAACAGTTGATCACATAGAAACTTATCC
AATAGTGCAAGAAACAGAAGAGATTGCAAAAAAGATTGCTCTAACGAGAATTATTTTAGC
ACAAACAAAGCCTAGAATCGATAAAGTGGTAGTGTCACGTCACGTTCAAGCCGTAGCAAC
AGTGGTCAATGTTTTTGACAAGAGGGCCAATTCGGACTTTTAATACAGTAGAGCGCGGTT
GTCCCTTCGTTGAAAACCAAAAACTTTTTTAAAGAATAAAGTGGGGAAAAATGAAATANC
GTAAACTTTGTCCAAAAAGNNAGGAAGAGGAGGTGGGGGNGTGAGGGCAAGANTATGGAG
ACTAGTTTTTTAAAAAAACTGGNGATGAATAGGNNNATGAAATTCATGAAAGGGTGGAAG
GTAAATTTTTATGCCGCACACGCAGACAGGAGAATGAGGGGGGAGGAGGAAGTGTTAGAA
AGCGTATGAGAGAAAAAAAATAAAGATTAGGGGATTGTAGGGCCCCTCCGGAGAAAGAAA
GAAAAGAAAAAAAAATTCTTAACGGTTATTCAGGAGGAGAGGAGAGAGAAAGGAAGAGGG
GAAATACATCATGGCAAAAAGGGNNN
Quality >S03036-02_A07.phd
4 3 3 4 3 2 4 3 5 4 12 12 5 10 6 9 5
14 9 9 12 6 7 5 5 9 8 7 6 8 5 9 5 5
8 6 26 18 15 18 20 6 9 9 16 14 7 9 5 6 7
19 20 32 26 21 24 20 19 12 25 18 9 9 9 13 21 43
32 34 30 14 26 21 25 21 27 24 36 29 39 12 43 26 26
29 26 26 27 37 37 35 49 49 40 41 34 40 35 32 33 37
37 39 34 38 38 31 43 36 42 42 44 38 35 36 30 42 35
42 31 35 26 39 39 39 39 35 42 60 47 44 42 35 44 31
47 47 54 44 47 60 60 44 44 60 50 39 47 60 57 60 60
57 52 57 60 60 60 44 47 47 57 52 57 57 52 57 52 52
57 44 44 42 35 47 52 35 57 33 34 52 52 60 57 57 60
60 46 46 44 39 42 57 47 57 57 52 60 43 41 60 57 52
57 52 57 57 60 47 52 47 52 52 57 52 57 57 52 40 52
60 52 46 57 57 54 52 57 52 52 52 42 47 46 47 47 47
60 46 39 29 27 35 35 47 22 47 28 35 60 52 52 57 60
57 63 63 63 57 57 46 60 57 60 57 52 52 60 58 58 46
47 60 60 58 58 60 49 60 47 49 63 60 63 44 44 47 47
47 51 49 47 47 42 45 47 51 63 54 60 42 32 49 54 54
44 47 47 47 60 58 43 45 31 63 43 41 40 49 44 45 30
47 46 47 60 42 47 40 45 60 60 60 60 44 44 60 47 46
42 44 36 54 22 39 27 39 35 35 39 42 39 49 22 38 27
39 42 38 9 36 32 42 39 35 54 36 35 36 42 59 42 42
42 31 36 46 42 39 50 39 44 27 42 43 39 25 39 42 42
39 43 42 38 19 35 46 39 36 39 39 35 42 42 35 44 35
47 44 32 49 47 47 54 54 50 60 44 47 44 44 22 47 60
42 13 39 28 35 28 44 31 47 42 60 47 44 44 42 30 27
22 44 19 19 13 44 26 19 35 25 39 46 20 33 15 13 19
20 12 9 17 11 9 11 33 25 21 35 19 29 11 10 16 9
25 17 16 23 8 9 19 42 41 19 26 9 20 15 11 35 22
22 26 19 18 18 14 9 10 16 12 9 21 28 14 36 32 24
30 35 13 9 9 32 19 28 46 53 14 31 9 35 18 14 32
11 13 12 14 27 11 11 10 9 10 12 30 25 20 20 19 15
9 10 27 20 14 20 12 22 35 46 32 24 21 11 27 40 40
12 24 20 32 14 14 15 14 17 21 14 22 16 19 20 22 13
28 10 20 19 11 10 11 11 23 32 32 15 11 19 25 13 27
14 13 8 7 10 10 10 15 11 10 19 16 19 13 15 10 11
10 24 15 28 22 19 10 7 7 12 10 24 11 14 11 10 8
10 11 12 11 9 11 10 23 25 11 6 9 8 11 10 9 11
9 12 15 14 17 28 7 9 15 11 10 9 15 10 12 18 9
9 8 11 11 14 10 11 12 18 12 18 15 13 16 24 16 13
17 13 7 10 11 13 20 17 13 11 17 11 15 7 6 6 13
19 13 26 16 11 10 11 8 9 9 15 24 15 13 23 11 9
9 14 10 8 12 11 14 17 14 27 10 8 12 9 11 18 16
13 17 17 11 18 15 11 10 11 14 13 16 15 10 10 8 12
17 12 14 12 9 8 9 9 8 18 40 28 27 28 23 18 19
19 16 19 20 17 16 16 13 12 15 13 19 28 14 14 22 11
16 20 20 14 20 20 23 18 19 13 17 15 14 16 25 27 23
18 11 18 20 24 17 17 13 13 18 20 22 17 15 16 13 14
13 13 17 13 11 16 23 17 13 16 13 11 8 14 19 27 17
20 28 19 13 11 14 21 14 11 14 9 13 11 19 17 17 12
12 15 11 8 10 17 23 20 16 14 19 14 9 16 19 22 22
20 19 20 18 12 14 14 16 13 14 19 9 9 10 23 15 18
14 12 10 11 15 27 28 22 25 17 18 17 20 22 16 28 23
23 23 20 18 22 18 19 21 17 19 23 18 20 18 25 19 27
17 20 14 14 9 6 5 6