S03036-02_A08
Seqid S03036-02_A08
Sequence >S03036-02_A08.phd
NNNNNNNNNNGGGGCGNAATTGNNGGCNANTCGGCCGAATTCCCATGGGGATCCGATGAC
CAGATAAATCATAGATAAAATGGCTGAATCCCATAGACTATACGTTAAAGGTAAGCACTT
ATCCTACCAAAGATCTAAGAGAGTTAACAACCCAAATGTCTCTTTGATTAAGATTGAAGG
TGTTGCCACTCCACAAGAAGCTCAATTCTATTTGGGTAAGCGTATCGCCTACGTTTACAG
AGCTTCCAAGGAAGTCAGAGGTTCCAAGATTAGAGTTATGTGGGGCAAAGTCACCAGAAC
TCACGGTAACTCTGGTGTCGTTAGAGCTACCTTTAGGAACAACTTGCCAGCCAAGACTTT
CGGTGCCTCTGTCAGAATTTTCTTGTACCCATCTAACATTTAATTAAGTTAAGCCAAAAC
AAAATTATAATTATTGTTATTAATATTGTATAAAATATAAAAAATAAGCATTCATATATA
TNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTACCGGCCATAAGGGCC
AGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGNCATAGCTGTTT
CCGGTGTGAAATTTGTTATCCGCTCACAATTCCCCACAACATACNAGACCGAAAGCAACT
CCACATTAAATTGCATTTCGCCCACTGCCCCCTTAAAATAGCCAACGCTCGGGGAAAAGC
GGGTTTGCANGAAGGGGGNCGTNNCGGAATATAAATTAAGTAAATAAAAAAATNAAAAAA
ACTATTACGGCAACGGGTAGAGCAGGGAAGGGGGGGGTAAT
Quality >S03036-02_A08.phd
2 3 2 3 3 2 4 3 2 2 10 21 25 20 13 15 3
14 10 12 16 13 5 5 20 13 9 7 8 5 31 34 40 22
16 35 41 32 15 32 41 28 28 22 13 35 50 45 50 49 16
16 40 34 35 43 38 40 31 42 26 28 49 44 43 50 49 47
42 42 35 49 50 40 44 42 54 54 54 42 38 49 42 47 45
50 50 59 54 54 54 50 44 50 49 44 45 45 50 54 60 60
49 49 58 50 54 60 50 54 58 57 60 54 54 60 52 52 60
58 60 57 60 60 52 60 52 52 52 57 60 59 54 52 63 63
58 63 60 63 58 63 63 63 63 63 63 63 63 63 63 63 63
63 57 63 63 63 63 63 63 63 63 63 63 63 63 52 58 57
63 60 63 63 63 63 63 63 63 63 63 63 63 43 63 63 63
60 63 63 63 63 57 57 52 60 57 63 57 60 63 63 58 57
60 58 63 63 58 63 63 63 63 63 63 52 60 57 57 57 52
52 60 43 40 43 52 52 60 42 43 43 57 63 63 52 60 60
52 63 63 58 63 63 58 58 57 52 63 63 63 63 63 63 63
63 63 63 63 54 63 63 63 63 58 52 63 63 63 54 58 63
63 63 63 57 57 58 63 63 63 63 63 63 63 57 58 63 63
54 63 60 59 54 58 54 63 63 63 54 63 58 60 57 58 63
63 63 58 52 63 63 63 63 63 49 63 60 63 50 58 51 60
63 63 60 54 63 54 57 52 54 59 57 59 44 57 57 59 59
59 59 59 59 57 57 54 50 50 54 57 50 50 49 49 51 49
54 57 57 57 57 53 51 57 49 46 57 59 59 59 59 59 59
59 57 50 38 57 57 57 54 54 57 57 54 54 54 54 49 50
59 59 57 50 57 51 59 50 57 50 54 57 54 54 50 59 54
54 50 54 54 54 50 50 50 54 54 49 49 49 51 47 46 49
51 49 54 54 51 49 51 51 50 51 53 35 50 49 35 50 50
51 49 50 42 46 49 46 49 46 42 42 35 43 35 35 35 32
35 37 43 26 31 32 27 36 35 54 38 42 35 36 21 29 21
35 35 38 32 23 5 7 9 12 11 17 25 38 35 43 38 30
32 30 25 22 18 12 14 22 18 19 22 26 30 30 27 27 32
25 27 26 25 28 38 32 30 18 19 10 12 31 38 30 33 35
41 42 36 36 32 32 38 30 21 35 32 30 32 30 27 33 31
32 29 32 23 32 27 33 34 35 17 23 23 22 30 38 40 19
21 15 20 38 32 38 50 43 19 21 12 16 50 35 43 21 21
25 11 13 31 27 29 13 22 30 21 7 9 9 12 17 14 19
30 32 21 29 21 30 16 9 20 11 21 11 16 21 31 29 14
19 11 11 16 19 18 13 18 17 19 21 14 9 13 11 17 36
44 34 26 22 9 19 18 16 18 39 16 12 13 14 8 6 13
10 9 24 9 9 11 25 44 16 28 13 16 19 11 11 11 15
12 18 11 11 19 23 23 17 15 11 14 13 19 23 10 10 12
24 14 14 11 32 15 15 18 31 33 27 31 13 20 27 16 16
15 11 11 13 20 13 32 35 20 20 17 11 10 12 11 32 34
33 24 32 16 19 12 11 11 18 17 15 17 19 13 11 6 13
28 11 26 13 23 11 25 7 9 9 19 6 7 12 12 14 14
10 11 19 16 14 11 10 14 12 11 16 14 11 11 15 9 10
19 34 32 28 17 14 9 11 7 14 15 27 32 28 26 13 11
11 17 13 15 17 13 19 18 11 18 10 12 10 12 10 15 15
12 11 10 11 11 11 15 11 19 11 13 32 23 19 20 32 13
13 10 10 11 9