S03036-02_A09
Seqid S03036-02_A09
Sequence >S03036-02_A09.phd
GNNNNNNNNNNNNGGNTCNAAAAAANNAAGNGATTGGCGGCCANTCGGCCGAATTGNNAA
ATCTGATAAAAGAATAAAAGAATATCAATAAGCCAAAATGGAAAACGATAAGGGTCAATT
AGTTGAATTATATGTTCCAAGAAAGTGTTCTGCTACCAACAGAATCATCAAAGCCGATGA
CCACGCTTCTGTTCAAATCAACGTTGCCAAGGTTGATGAAGAAGGCCGCGCCATTCCAGG
TGAATACATCACTTACGCTTTGTCCGGTTACGTTAGATCCAGAGGTGAATCCGATGACTC
TTTGAACCGTTTGGCTCAAAACGATGGTTTGTTGAAGAACGTTTGGTCTTACTCCCGTTA
AAAAGATAAATATTGAATAAAAAGAAGGGGGGAAGTCGTTTATTCAACGTTTCCCTAACA
TTTATTTTCTATTATATTATCAATATTTAATCTATATATAACTTACGTACCTGCCACAAC
TACGANAACNGAGGGGGGGNGAANTTTANATTTTTTTTTTNTTAAAAAAAAAAAAAAAGA
ACAGAGGNGGGGTACGGGCCTTTAAGGGCCAGCTTGAATAATAAAAAAAGAANCCTACAC
TACCCTGGCGTAGAGAGGGGGGGAGGGGGGTTCCTGGTGTAAANTTTTTATCTCTCTCAA
AAATACAAACAAAAGAGAGNCCGGAANCGTAAATTTTAAAGCCTGAGGGGGAAAAAAAAA
AAAAACTAANACCCCTCTCACCCCCCTGTGAGNAGAGTGGGGGAGNATGAGTAGTGTAAA
AATTTTTTTTATTCAANTTANATAAAAAAAAACGGAGCAACNCCNCTGGAAGCTGTATTT
GTTGTTAATGGGNAAGAGAAGAAAAAGAGAAACCACCCCCCCCCCAGCNNNNAAANAGAG
GAGCGGGGGAGAGAGAGAAGGAGTTGTATTTTTTTTAAAAAAAAAAAA
Quality >S03036-02_A09.phd
8 7 7 5 6 6 5 5 6 7 6 7 7 15 12 5 9
8 6 10 13 9 9 9 8 6 7 8 8 9 6 19 20 12
19 17 9 11 12 16 11 11 8 7 24 17 18 19 15 15 12
16 12 24 14 8 5 7 9 9 11 15 21 11 19 20 23 13
12 15 26 16 36 41 17 36 28 33 27 18 24 15 19 14 18
19 26 26 32 29 28 31 35 29 14 14 16 14 22 35 30 29
27 25 21 21 27 26 18 22 18 27 50 44 31 26 22 29 27
26 21 22 60 60 60 50 47 44 50 39 60 42 47 50 50 47
60 38 44 44 44 44 44 35 35 44 50 47 47 50 47 52 50
45 50 47 33 35 60 49 52 44 52 47 52 42 35 46 42 42
47 60 47 44 47 39 52 47 52 48 52 52 46 57 34 47 60
52 57 46 63 57 52 52 57 57 60 60 52 52 57 57 60 57
52 58 60 37 35 60 57 57 60 57 57 52 52 57 57 60 47
57 57 46 52 42 57 52 52 40 40 40 47 46 47 37 35 39
46 63 52 52 52 57 52 57 58 60 63 63 57 57 63 52 60
57 47 57 60 63 45 57 57 57 43 43 43 46 52 57 52 57
57 52 58 57 63 52 57 52 52 57 63 63 63 57 63 58 57
57 57 58 57 63 52 57 52 52 57 60 63 63 43 46 52 57
52 60 57 57 63 43 58 52 57 58 52 57 63 63 57 52 57
52 52 57 52 46 60 60 52 47 60 52 49 54 42 47 43 35
42 47 38 40 43 33 32 43 43 44 47 44 43 43 38 32 47
42 27 24 21 32 38 38 42 45 44 54 49 60 49 57 44 63
63 60 58 49 60 47 42 40 32 30 43 60 42 50 60 60 60
54 50 49 49 44 47 44 47 54 47 46 47 49 47 32 44 47
54 47 47 28 42 35 35 47 44 44 44 39 47 38 32 38 42
46 60 43 32 60 44 34 33 42 42 42 42 42 44 35 23 24
39 36 34 31 35 39 44 44 36 35 31 42 44 46 39 27 31
30 42 44 28 39 22 44 15 27 16 36 13 27 16 22 9 12
20 12 10 27 13 10 15 9 10 7 9 12 11 6 10 12 27
23 19 12 10 8 9 7 8 8 9 6 12 12 17 9 6 9
15 28 34 36 29 22 22 22 13 12 6 11 10 12 14 19 17
25 25 22 22 35 35 29 26 20 31 16 14 10 15 13 13 18
11 10 18 7 10 9 10 22 17 20 12 9 9 21 11 11 8
10 13 21 16 24 35 22 10 20 9 11 10 13 12 11 18 10
10 14 11 11 17 19 22 18 13 10 9 16 11 13 7 18 29
20 14 13 13 18 12 12 15 14 9 10 15 21 20 14 10 12
11 9 12 13 12 28 35 16 13 10 10 11 11 11 15 16 15
19 14 14 18 10 13 11 11 13 11 14 10 12 9 6 12 36
29 35 31 13 23 14 14 11 13 11 19 13 18 28 17 18 10
10 15 15 22 18 27 13 26 16 19 14 11 10 14 13 11 7
11 18 16 18 10 16 7 9 9 29 14 13 11 14 12 11 9
9 19 22 12 21 11 13 15 10 9 18 10 24 13 24 20 14
42 25 21 15 27 14 14 14 24 24 24 14 11 24 14 7 11
10 31 15 22 11 10 11 12 9 11 14 10 14 14 9 9 21
13 28 10 21 6 8 9 9 28 11 28 11 30 18 24 9 26
7 9 8 11 14 14 9 10 14 22 11 10 17 15 22 17 19
19 14 30 15 22 23 14 16 9 14 9 16 11 9 7 16 27
18 6 14 9 12 47 47 33 29 22 30 27 13 9 10 11 9
8 9 16 19 12 6 9 9 7 12 27 20 11 24 9 11 11
11 10 9 11 19 25 23 14 12 25 14 18 16 18 13 32 17
10 10 7 22 30 9 32 12 46 16 17 21 15 14 13 10 13
19 11 11 34 13 24 14 14 27 14 15 15 26 18 26 36 23
24 16 28 10 7 7 6 6 11 10 13 7 9 12 13 19 16
8 41 13 53 33 47 47 35 22 46 9 53 13 33 16 15 15
28 14 11 11 10 10 33 10 9 10 14 22 9 23 27 15 15
12 32 14 23 14 17 47 33 40 47 15 24 11