S03036-02_A10
Seqid S03036-02_A10
Sequence >S03036-02_A10.phd
NNNNNNNNNNNNGGCGAATTGNGCGGCCAAATCGGCCGAATTGGTGCACAGGTATACAAA
GCAGAATGTCCCAAAAAAACGGAATTGCCACCCTACTACAAGCTGAAAAGGAAGCCCACG
AAATAGTATCAAAGGCTAGAAAGTACAGACAAGATAAGTTGAAGCAAGCCAAGACTGATG
CAGCCAAGGAAATCGACTCATACAAAATTCAAAAAGACAAGGAATTGAAGGAGTTTGAAC
AAAAGAATGCCGGTGGTGTTGGTGAATTGGAAAAGAAAGCAGAGGCTGGTGTGCAAGGTG
AATTAGCTGAGATTAAGAAAATTGCAGAGAAGAAAAAGGATGACGTTGTCAAAATTTTGA
TCGAGACTGTCATCAAGCCTTCTGCTGAAGTCCATATCAATGCCTTGTAATATTGCATTA
CATTCTAGTTTTCTAATCATATATCTTTTTATAATATAATACCAATAGAATAAAAATGTA
TAAACTGAAAAAAAAAAAAANNAAATAATAAAAAAAAACAAAAAAAAAAAAGNGGAAAAN
GATAANAATAAAGAATAAAAAAAAAAAAAAAAAAAAAAAAAAACAACCACTAGCCCCCCG
GGGGGGGGGGGGAAATGGGGTATTTNGTATNTCTCCCNTTNCACCTCCNNAAAAACAAAG
NGCCGANGTATCGTTGNTAAAATTNGNAAAANATAAAAAGAAAAAAACAAACCAAACNTC
GCAANNACAAGNNNNAAAGGGAGNGGNGGGGNATGGTGTTATNTNTTGNTTTGAATGTTG
GAGANACCNANNNCTNANTTGTACGAGGGACAGTGCNAGCGNGAATGGNGTNAGCGGTTG
TTCGNGCANANNTAGCNGTGNNCTATGGTAGGGGTCATANTTAAAGA
Quality >S03036-02_A10.phd
5 2 3 4 5 3 5 6 3 2 6 2 12 23 10 28 17
24 26 32 15 5 15 15 21 17 15 16 9 18 37 31 41 32
16 29 42 36 29 13 25 27 22 17 26 26 38 21 31 24 41
47 47 16 31 41 42 42 50 50 42 35 42 40 50 38 30 42
43 51 50 42 42 52 52 50 46 52 50 42 35 43 38 35 30
49 41 50 42 43 50 49 49 50 46 49 42 50 43 34 50 54
54 54 54 50 54 54 54 50 54 59 59 52 50 49 50 50 50
54 50 49 54 54 50 47 43 49 54 50 54 54 54 60 63 58
58 58 60 54 60 60 63 63 49 58 63 60 58 58 60 58 57
63 63 57 60 60 63 60 60 58 54 54 60 60 54 58 51 58
51 63 63 63 58 63 63 63 63 63 63 54 54 63 63 58 63
63 63 63 63 49 50 51 49 50 52 58 58 54 54 60 63 54
60 60 51 58 60 58 54 49 46 60 54 60 50 54 50 50 60
59 50 33 33 38 43 33 20 43 63 54 58 49 60 57 58 63
47 60 54 60 54 54 54 58 47 45 57 50 60 60 54 60 63
63 63 63 63 63 63 58 52 58 58 51 45 63 63 58 63 63
63 63 60 63 63 63 49 54 58 57 63 47 63 51 60 63 58
52 58 57 52 60 59 54 54 63 60 57 58 50 47 58 47 50
58 58 60 63 40 41 42 50 54 54 60 63 60 49 50 47 49
50 49 42 38 51 50 47 49 47 49 49 60 60 60 50 57 38
32 51 58 45 49 49 63 60 50 54 60 58 63 63 47 63 60
43 49 47 50 58 50 49 47 52 44 60 49 60 54 60 50 54
54 50 54 49 46 43 60 60 47 44 47 46 60 63 60 49 50
49 58 50 60 60 52 52 57 57 57 57 46 57 60 57 57 52
57 52 52 57 52 60 58 60 57 52 52 44 57 57 45 58 60
52 52 57 60 63 60 43 47 43 41 41 44 43 47 57 57 57
60 52 46 43 41 29 29 40 44 52 44 47 47 47 34 34 34
36 47 43 35 25 21 35 60 42 52 40 35 29 29 22 18 19
28 47 41 30 40 47 35 27 32 28 34 11 8 9 13 20 15
32 24 10 13 17 13 9 6 7 9 19 18 9 10 11 9 13
15 25 16 14 33 44 46 25 11 44 46 47 41 27 20 18 19
19 14 12 14 10 7 8 14 8 25 13 13 6 10 20 10 8
12 6 18 12 11 12 11 9 11 12 11 11 20 11 32 23 18
21 18 46 36 15 15 19 25 19 42 13 22 28 16 9 18 22
31 28 13 9 22 9 11 15 11 9 11 9 11 9 14 14 13
11 18 27 9 11 9 14 19 19 9 11 11 24 20 17 11 13
11 10 8 9 11 13 11 23 16 9 9 12 9 6 8 13 11
9 6 9 11 13 11 10 9 7 10 8 6 9 10 9 9 16
8 9 7 7 13 9 15 13 9 9 19 19 8 26 6 9 10
11 11 14 6 10 9 9 10 10 9 10 13 10 7 9 12 28
24 9 9 11 7 10 7 8 11 11 19 6 11 9 16 19 13
18 9 9 9 19 35 12 38 28 9 9 9 28 17 11 10 11
14 11 11 7 11 13 11 14 11 11 6 6 8 11 11 10 14
6 6 6 6 9 9 9 9 9 12 11 13 6 14 9 6 26
12 11 12 6 19 16 9 8 13 9 10 10 14 10 6 15 6
13 24 13 6 18 12 25 12 16 14 23 9 9 11 9 10 13
15 16 6 9 9 9 7 9 6 6 6 9 11 6 9 6 9
9 10 10 9 9 14 9 9 10 11 23 9 8 8 10 11 9
6 8 14 11 10 7 9 11 17 10 10 9 6 9 11 6 14
10 13 10 9 8 9 11 8 10 14 9 6 9 8 9 6 8
6 6 9 10 9 10 5 10 9 12 6 7 9 9 10 13 8
14 14 11 9 14 10 11 9 8 8 11 9 6 8 10 14 10
10 12 12