S03036-02_A12
Seqid S03036-02_A12
Sequence >S03036-02_A12.phd
GNNNNNNNNNGGNGANTGNGCGGCCAATCGGCCGAATTGATCCAAATAAATCAGTCTAAA
AAATATAAACAGGCATAAAACTCAGTCAGTCAAATCAGAGTTAATATTGTAATTATCTGA
AACTAGTTCCTATAGGTTGAGTGTCTATCAAAAATTTACGGAGACGCGATGAAAATTGCG
GTAGAAACGACACTATTCGACTTCTTTGTCATCGATCAGTTTAAAAAATCTACTTTTTCA
GCGCCAAACACCAAAGTTGACACTATTAAGGGTTGTATTAACAAGTTTATTGAACAATTT
AATGTATATGATGAGCAACACATATTTTGGCAACCTCCTGGAAAATCAAACGTCAGATTG
CTGTCAAACGCCAATGACTTTGGCCAATTGGGAAACTTTTTGCATAAGAAAATCAAATGT
AACATTTTTATTGGAGAAGAAGCATTAAGGAAATACNATTTGACTATCTGTGGACCTTAT
GACAAATTTNTTNAAAATTCTGGCCCTAGTGTTAAGAGGGGGTGAGCCGAGNTGATGNCN
TATGGGNGGAAAGNGAANNACCACCTATANCANACCTCCCCGATGATGGGAAGTTNGGGT
CNAACGCANCAAGAAAATTGGGGAAAAAAAGANNAGAGTNNATGGTATAATGAGTTGCTG
CGGTNNAGATTACTGACACANAAATAATATAANGNATCAAGGNGGTGATGTAAGTAAAGG
NGGGNAGCGTNAACAANTGGGNGAANTNAAATCNNANCACGGANGNAGAATGTAATNNNT
AANAACAGNGNGAGATGNAGNATGACCGTNAATGGGCGCCTAGNNGAAANNANTCGGGAT
AGGAGCANANTTGTANACATT
Quality >S03036-02_A12.phd
8 6 2 5 5 5 6 5 4 3 8 9 5 8 9 6 14
9 3 12 13 32 15 15 15 20 13 22 34 36 19 23 31 35
31 23 29 30 30 9 21 37 25 11 24 29 31 28 30 36 35
31 26 31 46 50 51 49 49 49 49 46 39 30 46 42 35 35
35 42 35 54 46 59 34 38 28 28 31 32 49 50 42 31 32
42 44 32 47 42 44 39 42 47 47 50 44 47 60 57 57 57
60 60 57 59 52 57 58 60 60 57 52 52 60 53 57 52 53
58 60 60 52 52 52 57 60 58 60 57 54 57 57 57 57 58
57 57 60 63 60 63 63 57 63 63 60 63 63 63 63 60 58
58 63 63 63 63 63 63 63 58 57 54 58 54 58 57 52 53
63 63 63 63 63 63 63 63 63 58 63 63 63 58 63 60 58
63 57 53 57 60 57 58 59 63 63 63 63 58 63 63 58 60
60 60 57 57 57 52 52 57 57 60 52 57 52 43 42 46 60
42 46 60 57 60 60 52 58 63 58 60 63 60 63 63 63 48
52 52 57 58 58 57 53 52 57 57 60 60 53 53 52 57 48
57 59 63 60 58 52 60 63 52 57 57 54 60 60 52 63 52
52 57 63 60 57 52 58 52 52 60 57 60 60 60 60 52 60
52 57 52 60 60 52 52 57 54 57 52 52 57 52 52 60 60
60 57 52 52 58 52 57 57 57 57 57 57 57 47 60 60 60
60 54 60 60 60 60 50 54 44 54 50 60 49 60 54 47 49
60 47 49 49 44 44 60 47 49 60 50 50 54 60 54 44 45
35 49 49 47 60 49 44 40 38 38 33 50 47 50 47 35 46
60 50 51 49 54 54 59 41 42 47 44 31 57 60 57 52 57
47 52 57 57 57 54 57 57 57 52 60 57 44 57 32 57 46
43 23 23 40 60 47 43 21 47 60 52 28 39 42 35 35 35
35 46 47 47 52 46 60 35 9 32 30 35 40 31 41 27 21
46 33 35 31 28 18 42 52 25 31 34 27 29 26 7 15 36
31 28 41 46 23 29 24 18 22 22 26 21 13 9 9 17 41
26 42 33 41 53 19 16 9 20 60 32 42 16 6 9 8 6
23 47 47 37 24 19 11 9 20 38 33 44 27 16 26 12 11
28 20 21 18 10 10 11 14 17 11 9 24 15 12 18 10 13
11 14 16 13 6 14 9 28 9 19 6 9 6 10 9 9 8
18 9 6 10 10 11 13 11 11 6 14 11 9 6 6 11 11
8 10 16 14 11 20 10 10 7 9 10 6 10 11 11 9 14
9 12 9 11 18 16 10 10 10 12 10 10 40 19 14 10 10
7 10 13 9 10 10 7 11 10 11 19 13 10 6 8 18 17
14 10 11 13 24 17 15 11 10 13 17 28 16 9 9 9 9
19 9 8 6 6 10 21 11 11 8 7 6 9 8 9 10 10
11 14 10 13 12 9 9 11 11 11 11 12 14 11 8 11 14
8 6 6 9 10 28 11 11 14 8 14 13 9 10 10 11 9
7 12 11 14 11 15 13 10 11 11 9 9 7 12 7 9 8
9 9 10 8 10 7 9 10 9 11 9 9 9 8 11 12 11
8 9 9 11 10 9 6 10 8 11 6 9 8 10 9 10 6
12 11 11 9 11 6 9 9 9 9 7 10 8 10 7 8 7
9 9 9 9 9 7 7 9 7 11 10 11 10 11 9 6 8
6 9 8 10 11 11 9 10 11 13 9 6 6 6 8 15 10
7 9 8 9 11 16 6 11 6 20 9 10 10 14 10 7 9
10 6 16 10 11 14 8 12 8 10 6 9 11 9 14 11 8
9 9 9 9 10 9 11 6 6 14 14 11 11 6 6 8 6
14 9 11 19 11 9 8 9 10 9 9 10 8 9 6 9 6
10 10 9 11 10 6 9 9 11 9 9