S03036-02_A13
Seqid S03036-02_A13
Sequence >S03036-02_A13.phd
GNNNNNNNNNNNNNNAGGCNCCGANNAANAAGGNGATTGGCGGCCGGTCGGCCGAATTGG
GATACCAAGCTATCTGTAACAGGAGCTAAAAAATCTCAGGGAAAAGCTTCTGGTTTGGGA
AACGAAGGAACTCCAATCGGGAATGAGGAGAGCAAAAATGGAAATAAAAAGAGGAATAAA
AATCGAAACAGAAATAAGAAGACAGAGACAAAGGAACAAAATGAACCTAAACCTGTGACT
GGAGGGGAAGAAGTGAGAGTCGAGAAATCTCAAGCGAAAAACAGAAGGCGGAAAAACAAT
AATGGAGCTAATAAAAAGAATACCCTACACTACTCAAAGGAAATTAATGTAGAAGAGCGA
AAACAAATCGCAAAAAGGCAAGAAGAAATCGAACAATGCATTCACACCTTATCCGATTTT
AAACTGTTTAAAAAGGGTAAGCACGTTACCTCATATGGCTATCGAATCTCCCCCATGACA
GACTCCGGTAAGATTTCTTTGAAAATTTTATTCAACATACCTTTGGATTATCCAAAGGCC
CCAATAAAACTAACGATGAAAAGTAATGAAGAAGTTTCCTCTTACATGGACACCGTGATA
GCGCANNNCANCTGGAANAACGACAATTGGNTANGGATTNTGTTNGATATTANCTCAAAA
NNACTANTTGGTTAGTNAGCTACANATAANCACACAGGAAATAATAAAAAAATAAAAAAA
ACCNCACACTCCCTCTTCGCAGGCGGGGNGGGGAGGGGGAGNAGTATAATGTATATTTTT
TAAAAAAAAAAAAANAAANAAGCNATCCCCCCCCACGTATAANAGGNAAAGAAGAAAGAA
GAAAGCAAAACAANCCCACTCCCCCCGGCCAGAGGGAGAGGGGGGGAGGGAGAGGGAGAT
ATNATAGAATAAAACNNN
Quality >S03036-02_A13.phd
11 5 5 4 5 7 4 5 6 6 6 5 5 6 7 9 15
12 10 7 8 12 11 9 6 7 9 8 6 12 12 10 10 6
21 17 18 19 15 10 9 17 19 12 9 9 9 14 12 15 16
16 19 16 15 9 25 18 10 9 11 10 13 23 16 24 19 26
21 22 28 29 29 16 21 34 16 20 36 13 23 26 36 26 26
26 17 12 16 28 30 35 35 36 32 28 27 16 9 26 17 27
28 30 30 35 31 35 32 30 28 35 32 21 26 37 35 46 41
29 37 35 31 29 49 42 32 50 38 33 38 50 42 42 32 42
54 43 36 35 46 41 54 44 54 50 44 54 45 45 45 57 54
57 51 51 57 54 57 53 51 50 49 45 53 50 49 46 50 43
49 50 44 54 50 50 52 43 43 43 54 50 50 50 42 49 49
49 49 50 49 53 49 45 51 49 49 63 63 49 49 45 50 50
50 50 44 41 54 39 47 44 47 60 50 50 50 60 47 60 44
50 60 47 50 49 47 47 44 42 42 42 42 42 60 44 47 44
35 32 47 60 36 52 63 63 60 52 57 52 63 46 60 57 60
60 52 52 60 60 52 42 57 52 44 60 52 52 60 60 52 57
57 60 57 57 57 63 63 63 52 57 52 60 57 57 52 63 57
52 58 58 57 60 60 57 57 57 60 52 52 57 52 57 52 60
60 57 52 52 57 60 57 60 57 57 60 60 63 52 44 57 57
57 60 52 60 57 57 57 52 57 57 60 52 47 52 57 44 46
52 43 37 44 52 40 40 35 44 35 35 27 44 60 42 57 44
35 32 40 32 20 21 40 34 35 47 52 57 35 57 60 60 57
52 52 63 63 60 60 57 60 57 60 47 57 60 42 52 47 35
57 57 60 52 57 57 52 57 52 52 60 35 42 57 57 52 60
60 52 57 52 60 57 57 52 57 60 60 52 42 57 52 52 57
60 57 57 52 57 57 52 60 52 57 60 52 52 60 60 57 57
57 52 60 43 43 57 47 44 46 46 44 52 52 60 57 52 47
57 42 46 42 42 42 46 34 60 43 44 44 35 40 35 29 47
46 44 44 39 35 43 40 42 40 40 32 40 21 35 34 35 46
21 29 22 22 24 42 32 27 35 40 38 47 47 49 49 49 35
47 42 35 25 19 22 21 35 17 21 27 40 43 49 44 60 38
26 35 21 22 31 26 42 49 47 42 47 35 44 42 38 35 47
42 44 47 47 47 47 35 44 39 42 44 44 42 25 36 32 29
17 16 27 22 44 35 44 33 44 16 15 26 16 24 13 11 18
19 9 21 15 15 29 13 16 16 23 14 26 22 31 28 29 15
12 21 12 17 21 9 35 9 11 12 7 5 5 12 8 6 27
24 35 17 11 9 7 9 8 9 18 10 9 11 13 9 13 27
22 6 22 11 7 8 20 24 9 9 7 9 9 9 9 7 8
12 28 10 14 9 11 6 11 9 11 12 11 19 9 7 6 9
21 18 13 6 9 9 11 14 11 23 21 16 9 6 17 21 11
12 9 9 9 6 14 15 12 9 6 8 11 11 14 11 11 12
10 9 18 33 11 14 24 14 16 44 33 21 28 25 35 12 13
12 15 21 14 25 15 15 14 10 6 10 8 9 11 19 12 16
15 16 11 12 10 18 14 12 24 14 10 12 12 13 13 11 14
6 18 10 12 12 10 11 13 10 10 12 10 10 6 8 9 9
12 22 18 14 13 19 16 15 10 9 15 15 12 18 28 31 17
14 12 14 14 10 13 33 17 9 9 18 11 7 12 19 8 7
13 14 15 10 6 9 9 12 18 15 12 12 10 22 15 8 17
10 9 12 12 9 9 6 12 10 9 7 15 31 22 10 14 20
11 31 21 28 12 25 44 18 25 16 16 11 10 10 13 12 9
11 10 9 6 10 15 11 9 9 8 8 12 12 15 16 9 9
9 11 9 12 14 13 14 14 21 19 38 9 23 22 17 16 18
18 13 9 10 10 12 9 22 9 19 13 13 11 9 10 11 13
8 7 8 12 10 11 11 11 17 13 23 9 14 8 6 7 6