S03036-02_A14
Seqid S03036-02_A14
Sequence >S03036-02_A14.phd
NGNCCCNAAAAAGGNNATTCGANANNNNNNTCGGCCGAATTGTTNAGAAAATTTATCATA
TAATAATATGGGTATTGCGAAACATTCTTGCGACTGCTGTCGCGTTCGTCGAGTAAAGTG
TGACAGGAATAAACCATGTAATCGCTGCACTCAGCGCAATTTGAACTGCACTTATCTTCA
ACCGTTGAAAAAGAGAGGTCCAAAATCCATTAGAGCAGGAAGCTTAAAAAAAATAGCGGA
AGTGCAGATGGTGAGTATGAATAATAATATTATGACCGCTCCGGTGGTATGTAAGAAGGT
TCCGAAAAACCTGATTGATCAATGTTTGAGGTTGTATCAGGATAACTTATATGTAATTTG
GCCAATGCTTTCCTACGATGATCTTCACAAGCTTTTGGAGGAAAATTATGAGGACTGCAG
CACTTATTGGTTTCAAAAATCCANTTCGNCAGTACCCCGNCNGAGGGNNAAGGGAAAGAG
AGTTTGATCCTTCATNNTTNTTTTTCATGGAAGAACNTANGGGCGNNGAGTAGTGGNTTN
TATTAAAAGAGGAAAGGNAAAAAAAACANACCCANTTNCTCNCCCCAGNGACCACAANGG
GGTAAAGGTTAAACTTTTTTCTATCTTATNTTAAGCAATANNCGCAANNGTGNCGTACTA
GCATANGAGGAACGTTNAGATGGAAGAAAANAAAACAGACACTNCCCNACGCACANGGGA
GNAANTNNNAGAGGGNGGNANTTTNCTATTTNTTNNTNTANTANTNTCATNNNCANNNGT
ACNTNGAGNNGANGGCAACTAGAAAAANAGANGAAAANTACACACANNACCCACCCACCG
CGCGCGCGTGCGGAGAGGAGTGANGACAAGAACATTNTANNNNNNACN
Quality >S03036-02_A14.phd
7 8 6 8 8 10 7 8 12 15 11 8 9 9 5 6 9
13 15 9 12 9 6 9 7 7 7 5 5 5 11 9 10 9
14 10 12 19 10 30 24 11 12 10 6 11 12 21 22 19 9
14 35 31 17 29 16 29 24 31 23 23 20 16 19 20 15 11
9 11 9 9 29 32 33 42 42 32 24 20 27 19 27 9 10
32 40 34 28 42 21 12 17 23 14 42 42 32 47 39 32 32
36 53 50 46 53 31 40 35 10 42 33 28 21 23 19 32 40
53 41 40 32 53 31 22 42 32 39 53 44 53 53 53 52 52
57 57 52 60 60 53 60 44 53 46 53 57 53 52 52 53 44
41 42 50 50 40 50 52 57 60 60 52 57 52 60 60 53 53
52 53 57 60 60 52 57 57 52 53 53 57 60 57 57 52 52
52 53 50 53 50 40 42 40 53 53 53 42 37 37 18 26 26
40 53 60 52 50 50 39 35 26 42 40 40 26 35 44 27 26
40 26 26 21 23 18 24 38 40 38 40 53 53 42 34 39 33
34 53 40 40 53 53 53 40 38 53 53 53 53 50 53 53 52
52 57 52 52 57 52 53 57 53 52 57 57 57 52 52 53 53
45 52 57 57 60 60 57 52 57 57 53 57 57 57 53 52 53
52 52 53 44 53 53 53 46 53 52 47 47 53 60 42 53 57
57 53 53 37 42 38 44 53 53 53 53 53 42 45 38 41 33
37 35 33 31 40 39 28 37 33 35 26 27 34 29 28 19 11
28 19 20 19 23 27 38 40 32 28 34 27 41 34 32 37 37
44 45 53 40 34 40 32 34 46 42 34 42 53 37 13 14 12
12 35 13 24 35 42 18 8 14 47 45 42 27 35 39 34 34
46 53 53 42 38 35 18 28 27 60 53 37 27 14 12 11 11
18 14 22 19 35 32 33 27 38 42 27 21 24 18 14 27 17
14 24 14 17 9 11 13 14 19 11 10 8 9 29 11 9 9
9 6 11 22 18 11 6 9 11 10 9 11 34 9 18 13 11
7 9 7 19 11 9 9 11 7 6 9 13 9 11 17 9 16
15 16 22 11 12 10 10 13 12 10 19 13 11 10 9 11 9
9 10 6 6 14 10 7 14 9 10 14 13 11 13 10 10 12
30 10 10 8 9 9 6 10 11 6 10 9 14 9 14 6 7
8 16 9 9 14 17 11 8 11 7 11 11 7 9 16 11 10
8 11 10 10 11 10 18 11 11 13 12 9 11 7 16 20 21
18 13 14 20 18 11 21 7 16 14 13 18 11 7 8 11 6
9 9 13 6 13 11 11 10 9 9 7 10 14 9 13 9 9
10 9 6 10 13 10 11 10 10 16 10 10 9 16 11 9 10
11 10 9 11 17 18 16 22 10 19 10 14 11 12 22 14 11
7 11 11 11 11 18 9 11 18 10 11 7 6 11 11 11 13
25 6 6 10 11 8 7 10 9 8 19 12 17 11 14 10 11
11 9 6 10 25 10 11 20 11 9 11 9 10 6 11 10 10
19 9 13 19 9 8 13 16 12 12 7 11 12 10 24 20 9
11 10 14 10 9 11 6 16 28 11 6 8 9 9 9 9 11
10 6 11 13 27 9 11 6 11 8 6 10 6 6 6 9 9
13 19 14 10 6 10 9 6 9 6 12 10 9 7 9 9 9
9 10 12 6 12 9 7 6 8 6 10 9 6 9 11 6 23
6 11 9 9 9 6 7 7 8 8 7 5 5 9 11 13 11
7 8 7 12 11 21 6 7 11 11 6 9 11 9 12 11 13
10 12 11 26 28 13 9 21 7 8 9 8 7 8 27 10 17
9 7 9 14 17 8 9 15 16 10 6 7 9 23 12 16 20
12 16 13 14 27 21 17 23 11 10 11 17 11 10 15 9 13
10 18 18 13 10 14 18 16 12 14 10 10 9 6 10 8 12
11 13 18 9 16 13 11 14 11 7 13 11 6 7 7 7 7
6 9 11 6