S03036-02_A15
Seqid S03036-02_A15
Sequence >S03036-02_A15.phd
NNNNTTNCCTTTTTTCGGGCCCGCNNNNNANGGNNATTGGCGGNAAATCGGCCGAATTAT
TTCAATTAATAAGATATTCTGGTAATTTCTTATTCTAATTCTAGGAGGCAACACTCCATA
ACTAAATGTTTATTATAATAATATTAATATAAAGTTAATATCTCTTAGGTTACACGCAAC
TAAACTTTTATTATATATACTGGTTGCATTGTATTTTTATCATATATCTTAATATAGGTT
GTTTAAGGTTCGTTAATTCAAAAATAATGTTTTTTTGTTTGAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTCCCGGCCATAAGGGCCAGCTTGA
GTATTCAATAGTGTCACCTAAATATCTTGGCGTAATCATGGTCATAAATGTATCCTGTGT
GAAATTGTTATCCGCTCACAATTCCACACAACATACAAACCGAAGGCTCCACGTGTTAAG
CCTGGGGTGCNNAATGAGGGAGCTAACTCAATTTTATTGCTTTAAAATNAAAGACAGATT
ATACATCGGGANACCTGTNGTGCCAGCTGNATAAAAAAAAAAAAAAAAACACACCCTCNC
CACCCCGTTTGCGTATTGAGAGGGGGGGGAGAGTTCTTAANTATATTATTTTTTTTTNAA
ATAAGATAAAAAAGATAGCGAAAGCGGGTATCATCTCCCTTCTCCCAACGAAGCAANGGG
GGNAGGAGGANGAGGAGNANAATTTTAATTATACTTTTAAAAANATAANANAAAATAGNN
TACAANTTAATCCTGCGTTTCTTNTTAAAAAAANAGTAAAAAAAAAAACCACCCCACTAN
CCCGGCCTCAACGAGGAGGGGGGGAANANGGNATAAATNNTTAATNN
Quality >S03036-02_A15.phd
7 6 5 5 8 12 7 8 9 12 16 14 9 8 9 9 8
10 9 8 11 12 9 9 5 5 3 5 7 8 5 14 10 6
6 8 9 9 26 9 12 17 12 5 10 9 16 19 21 36 31
32 33 28 43 20 29 21 12 34 40 39 15 21 26 29 28 28
25 35 24 15 17 46 11 24 19 25 20 18 35 35 24 41 41
28 41 30 39 41 37 40 52 53 47 29 24 18 30 30 30 35
25 39 53 52 48 37 36 34 36 42 46 33 45 53 53 45 53
53 53 45 46 44 53 53 53 52 53 57 53 42 53 48 45 53
39 42 53 45 42 53 45 53 53 45 47 53 53 53 53 57 57
57 57 57 57 60 57 52 57 60 57 57 53 53 53 52 43 53
53 53 53 53 52 53 53 42 53 45 46 46 60 53 53 60 63
58 58 57 52 52 52 57 57 57 52 57 57 57 57 58 52 57
52 57 53 46 47 57 57 41 53 47 53 60 60 46 46 53 52
53 53 46 53 45 53 60 60 46 53 45 47 45 36 41 39 52
39 30 44 42 47 39 45 53 57 63 52 52 53 57 57 52 52
52 52 57 46 42 46 46 52 42 47 46 46 47 52 52 60 60
60 60 60 57 52 52 57 52 52 60 52 57 57 47 47 60 41
35 46 32 32 35 46 29 46 31 31 29 22 25 24 22 22 31
29 30 30 35 44 34 44 44 46 47 44 47 52 47 60 52 60
60 59 52 57 60 57 57 60 57 47 44 11 14 24 19 35 22
21 16 16 16 14 21 16 12 15 14 9 21 22 11 13 18 39
24 29 17 12 16 31 28 27 24 10 23 9 31 23 13 22 9
17 19 27 35 23 42 39 27 31 19 9 14 39 30 35 16 22
14 21 31 22 20 29 22 22 29 29 15 18 18 10 30 13 11
23 21 10 8 10 32 16 9 27 13 25 11 18 33 43 38 25
28 29 21 30 26 21 29 30 27 21 35 21 21 18 29 20 24
29 21 17 12 10 9 8 17 18 9 16 13 54 22 44 31 14
26 13 14 10 12 9 12 20 8 10 9 13 11 9 21 20 12
11 11 18 30 34 25 11 21 30 37 23 9 27 14 6 7 20
22 14 32 21 23 8 24 14 18 19 19 28 10 12 19 9 14
10 18 39 19 10 10 34 16 10 9 11 32 21 16 9 9 9
9 6 11 10 19 15 12 9 9 10 10 13 22 11 10 9 10
14 10 26 20 17 16 10 7 9 27 17 18 9 9 6 10 16
19 8 10 9 9 21 19 9 7 16 12 16 19 10 12 13 31
20 25 12 18 9 15 9 11 11 39 35 16 9 16 10 12 13
14 11 12 7 9 8 11 9 15 24 10 9 11 15 18 11 10
10 16 16 24 11 28 11 21 14 19 20 25 14 14 11 9 15
10 13 11 9 10 8 14 11 19 10 12 6 28 10 19 13 11
13 8 11 10 14 23 18 23 14 36 11 7 24 8 25 14 17
23 14 11 11 11 12 46 20 12 20 9 40 9 26 10 11 12
32 14 10 9 11 10 13 14 16 11 12 14 11 11 18 17 18
14 14 11 16 14 11 16 26 18 14 14 11 18 14 13 9 10
10 16 7 9 11 10 15 13 7 21 19 13 10 11 11 8 6
10 26 10 11 11 9 6 9 7 11 11 12 11 13 22 11 18
19 17 17 16 15 14 19 21 15 14 13 32 32 15 11 6 11
11 11 10 7 10 7 14 18 24 10 11 10 9 6 6 9 31
8 23 8 7 11 8 10 10 14 11 10 9 9 10 11 9 9
10 8 10 11 6 11 11 24 28 12 15 28 19 13 7 11 11
9 9 8 9 9 9 11 27 16 21 18 8 11 10 11 9 11
9 9 10 10 9 13 7 28 14 9 9 11 8 9 10 10 12
9 9 11 12 13 13 11 9 23 23 9 12 9 21 9 9 7
9 6 11 14 7 9 10 9 11 14 10 5 6 9 14 8 9
10 7 6