S03036-02_A16
Seqid S03036-02_A16
Sequence >S03036-02_A16.phd
CNNNNNNNNNNGGCGNATTGNGCGGCCAAATCGGCCGAATTGAAGTACAGAAAGCAAAAC
AATAATAAATAATGGCTAATAAAGTTATTCAACTACAGAAAATCTTCCAATCTTCCACTA
AACCTCTATGGTGGAGACATCCAAGGTCAGCTTTATACCTGTATCCATTTTATGCTATTT
TTGCGGTAGCCGTCGTTACACCACTTCTATACATTCCAAATGCTATTAGAGGTATCAAAG
CCAAGAAGGCATAGTTAGGTAAAAATAACATCCGTTCATAGCATCTTTATAATTGTTCTT
TGATATTAAGTGTGTATGCTCAATACACATCACCCAAAACATTTTTATTCGAAATAAGAT
GAAAGCCATTTATTTATATATACATATATAATATTCTAAAGAATAAGGAAACAACTAATC
GAACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AANGTACCGGCCNNAAGGGCCAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTNGGCG
TAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAAC
ATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACA
TNAATTGCGTTGCNCTCACTGCCCGCTTTCCAGTCNGGAAACCTGTCGTGCCAGCTGCTA
TAATGAATCGGCCAACNCGCGGGGAANAAGCGTTTGCNNTATTGAGCACTCNNNCGCTTA
CNCGCTCACTAGATTCGNTGCGCTNGGTCGNTTCGGNTGCNGCNANCGTATNCAGCTCAC
NTCACAGGCGGGAAANAGGGTANCNCANNATAGGGTGGANNNNNNNGANAN
Quality >S03036-02_A16.phd
12 6 4 3 3 2 6 7 5 4 6 12 12 8 10 7 27
18 14 8 3 10 8 20 17 18 13 17 23 33 31 42 42 19
30 46 48 36 20 31 41 31 17 19 13 34 42 33 33 44 49
49 49 42 36 50 51 51 52 41 52 52 49 49 50 47 52 49
42 42 46 46 35 49 42 47 54 49 54 50 54 54 43 41 43
46 50 44 54 44 39 42 42 42 29 17 22 38 44 60 50 47
44 54 49 43 47 52 52 52 60 60 60 57 57 52 52 52 52
52 57 60 57 57 60 48 52 60 57 57 53 52 60 57 63 58
48 52 57 58 60 52 52 58 60 58 57 57 52 52 63 63 63
63 63 60 57 52 60 60 63 58 60 57 60 48 52 63 63 63
53 58 57 57 53 63 58 58 58 63 63 63 63 58 58 63 60
63 58 63 57 57 57 57 57 60 58 58 63 57 63 63 58 52
57 57 60 58 57 57 57 57 57 57 57 60 52 52 57 60 57
57 52 35 47 48 52 52 60 57 57 63 63 53 63 57 57 57
63 57 57 52 57 60 57 63 63 52 63 54 52 63 63 60 63
63 63 63 63 63 63 63 63 63 53 54 63 63 63 58 63 63
63 63 63 63 58 59 63 63 63 63 63 63 63 63 63 63 60
60 57 63 58 63 63 58 58 60 57 60 58 60 58 52 57 52
52 57 57 57 57 58 52 63 60 57 58 63 50 57 58 54 60
60 60 60 60 60 47 41 47 60 63 63 52 59 59 60 58 59
59 59 60 60 60 58 60 50 58 58 54 63 63 58 54 54 57
57 45 34 57 57 57 57 50 57 51 51 51 57 57 54 50 53
57 59 59 54 57 54 54 59 57 54 57 57 54 57 50 57 57
59 59 54 59 59 50 57 59 59 59 59 57 43 59 59 54 57
59 57 57 54 59 54 50 50 57 59 59 59 54 59 49 46 49
32 26 37 40 43 54 54 54 54 54 54 54 37 35 35 35 46
46 43 35 27 24 28 26 35 35 33 33 28 33 31 35 32 31
33 35 27 35 35 41 43 38 41 35 43 35 52 46 46 49 52
52 49 40 46 37 21 6 18 21 9 26 31 28 23 28 30 7
7 13 28 32 36 20 29 34 28 27 16 49 34 28 28 18 17
20 36 30 29 18 35 21 46 37 18 38 21 28 17 35 26 18
27 20 19 17 16 16 21 13 6 15 20 16 17 16 26 17 18
26 23 15 22 21 19 32 36 12 37 27 18 19 20 25 22 24
29 22 16 26 9 27 18 20 21 28 27 24 38 20 28 24 14
23 28 30 10 18 18 37 21 22 35 16 30 34 30 31 15 28
30 18 44 40 20 30 20 30 27 19 31 15 30 16 27 16 41
28 16 24 17 21 26 31 24 23 26 30 19 24 30 21 13 27
29 26 35 32 40 28 22 16 29 14 15 33 24 15 25 27 13
13 13 24 22 29 19 24 26 28 24 28 25 15 16 18 6 12
16 26 19 13 12 11 20 29 17 12 7 9 18 12 17 13 15
12 12 35 22 19 17 33 34 12 9 11 28 17 13 10 7 16
27 21 27 16 18 18 20 14 15 14 12 11 17 24 24 15 12
24 22 13 13 8 9 17 28 27 13 15 27 30 16 24 17 24
10 12 25 27 15 6 16 13 21 26 9 23 8 27 25 7 28
11 10 23 12 12 35 21 10 18 6 6 11 17 10 26 11 8
14 11 8 12 15 8 6 5 6 14 28 14 16 16 8 15 6
12 9 18 20 11 14 14 16 11 8 20 12 17 11 12 6 24
15 12 21 8 27 7 11 11 17 12 12 7 20 10 10 10 9
7 13 10 14 7 21 10 6 12 6 24 20 10 11 13 7 16
12 8 11 18 16 9 10 6 14 16 10 9 11 20 15 9 25
23 13 14 14 13 7 8 13 27 11 13 11 6 8 6 9 9
6 7 16 13 14 14 26 23 9 19 9 10 6 6 6 6 5
5 7 9 10 5 8 5