S03036-01_A05
Seqid S03036-01_A05
Sequence >S03036-01_A05.phd
NNNTNTNNNNNNNNNNNNNNNNNNNNNNNNCNTANCTNAANCTGGNGNGANNNGNGTANN
CCTCGCNTNANCCCNCCGNNGNGNNGAGGNCTGCGNNTNNNNNATNNTTCANAGGNAGCG
NAGNCCACNCNTNNNNNNTNNNNNNTNTNNTNNNAGGNNNNGNGNNNACGANGNNNNCTN
NNNNCNCNNNNCNNNGNGNGNGNNGTNTNTNTTNTNTNTCNNTAGAAGAATGCNANANNG
CTCNNNNCNCNNNGAANGGNGNGACGAGNNNNCTNTATNATTTNTNTACCTNAAGANAGC
GANNNGNATGNNTNTTTNCNTTAAAAAANGTAGGGAGAAAAANNAAATTTTTTCNATAAN
NATGTGAGAAAAAAAAAANNANGTTATATACCAACACAGNTGAAAGGGGGGNAAGGGANT
TCTTTAAGTTTANAAANCANAAATTTAAAAAAAATTNCCCCCGGGGGAGGGGGGATAAGA
NNANATNTGTNTATTAAAAAAANATNTTNAANAACAAAACGAGATAATTCGCCANAGGTG
TGGAAACGGGAAAAGATTNATAAATATAATTAGAAAATTATAAAAGAAAAAAAGACCTAC
CCCCCCAGATNGCGANNANGAAGTTGGGAGAGGNGNANCAAATTTANTACTTTTNTCCAC
ANAGGTAGGNGAGGGAAGGGGNANCATAAGTAAANTAAAANGAACNCNGAT
Quality >S03036-01_A05.phd
7 6 5 17 6 11 3 4 7 2 4 2 3 4 2 2 6
5 2 5 3 3 7 3 3 3 3 3 5 5 10 5 9 10
6 21 14 5 9 9 6 14 21 8 12 6 21 6 24 9 7
7 5 8 6 9 9 10 5 5 13 18 10 31 8 27 7 29
5 8 7 9 9 11 6 13 16 15 3 3 8 6 10 6 5
9 9 8 10 5 13 16 18 11 13 7 5 11 7 6 5 7
6 10 10 6 5 13 22 9 8 7 14 11 17 5 8 10 11
10 6 11 10 6 11 11 9 8 7 8 5 9 6 7 5 5
5 5 8 5 5 7 5 6 5 10 6 21 7 5 11 7 6
7 20 9 9 3 5 3 5 12 6 13 6 7 6 12 10 11
9 6 13 7 7 6 6 9 8 5 7 7 5 6 9 5 8
5 7 6 6 9 5 5 6 11 5 21 6 19 6 23 6 6
13 9 5 14 6 26 5 9 13 6 11 5 19 7 15 10 7
7 12 14 9 11 9 9 14 27 11 14 10 7 13 7 20 6
6 8 10 18 17 7 7 5 6 8 6 8 6 5 7 31 9
12 6 8 10 3 10 6 23 8 10 18 13 18 7 6 6 6
11 26 6 12 8 10 6 11 24 16 11 6 10 6 10 9 9
9 11 6 8 9 9 22 7 12 16 11 10 9 6 6 7 10
7 10 10 10 7 6 9 6 8 9 9 6 11 7 16 9 10
12 16 11 10 12 7 12 8 13 9 9 9 16 14 14 15 13
9 9 6 6 9 9 10 10 9 9 13 14 11 8 7 9 10
9 10 6 7 9 17 9 11 10 8 14 19 10 16 19 12 12
10 11 9 11 7 6 9 6 9 12 12 9 9 10 11 11 9
10 9 9 9 11 8 16 14 6 9 9 10 9 9 11 9 16
13 9 11 6 11 11 10 11 11 9 6 11 14 11 9 12 9
10 9 8 16 18 16 9 6 12 11 9 6 11 18 6 10 11
10 10 12 18 12 16 22 13 18 9 11 11 9 15 7 18 14
11 11 9 20 15 16 26 14 14 10 22 14 8 10 18 10 9
9 8 10 8 6 6 10 6 9 17 6 10 11 10 7 11 11
20 11 11 11 18 27 20 15 16 6 15 9 6 8 8 7 9
10 6 11 20 15 18 14 20 13 9 9 11 9 12 11 19 19
12 10 19 10 16 15 13 6 10 12 10 11 18 10 11 13 9
11 15 10 12 16 11 11 10 9 9 11 10 11 9 7 14 11
27 17 26 25 24 17 14 14 16 11 16 10 12 19 16 18 8
9 34 11 15 9 23 11 13 9 11 28 32 32 21 24 9 11
9 15 10 13 14 13 12 15 14 13 10 8 13 10 11 7 9
11 8 9 6 6 9 6 12 15 14 11 9 9 13 9 16 9
14 33 12 11 7 10 6 9 6 9 9 16 17 19 16 16 16
6 9 11 13 13 11 9 9 6 9 9 10 13 11 10 7 29
11 12 14 11 10 10 7 11 13 13 17 12 11 10 11 14 9
8 7 15 6 8 9 12 10 12 10 13 10 10 10 7 9 14
29 27 14 6 10 12 13 11 6 9 7 11 12 9