S03036-02_A17
Seqid S03036-02_A17
Sequence >S03036-02_A17.phd
GNNNNNNNNNTNNTAGGCNNNTNNANNNNNNGANGAAGTGGCGGNCGNTCGGCCGAATTC
CCATGGGGATCCGATATCAAGCTTGGGCCCGTTGTATACTTTATACAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAAAAAAAAAAAGGTCCNGGCC
ATAAGGGCCAGCTTGAGTATTCTAAAGTGTCACCTAAATAGCTTGGGGTAATCATGGGCA
TAGCGGTTTCCTGGGGGAAATTGTTATCCCCTCACAATTCCCCACAACATACGAGCCGAA
AGCATAAAGGGTAAAGCCTGGGGGGCCTAATGAGTGAGTTAACTTACATTATTTGCGTTG
CGCTCACTGCCGGCTTTCCAGTCGGGAAACCTGTCTTGCCAGCTGCATAAATGAATCGGC
CACGCCGCGGGGAGAGGCGGTTTGGGTAAGGGGAANATNTANANATTCCCCGTTCCCTTA
CTCCCTGGGNTNNGTCGAATAGGNAAGGANGATTTATNTNTATTNACTCATAGGNGGNAA
NAAGGGAANACGNGGGNNCTTGGGAAAATGCCTNAANAAAAAAAGAAACAAANNGTTCAC
CCNCCTCGGNAGGCGNGGGAGGGAAAGNGAGGGGAATTTTNATATTTTTTCCTCCCGACA
AAAAAAACAACAANNAACAACCCAAACCTATCTAAGAGAAGAATAAAAAAAAANNCANCN
NNNACCATCNCTCATGGGTGGGAGAAGAGAGGGNAATATTTATNTTATTATTTNATAAAT
AGAAAAAAAAAANAAATAATNNACNGNANANATAANAATAAAAAAAAAAAGAAACACACA
NACCCGAGACCGCGGAGGAGTGGGAGGAGGAGTGTGCGTTA
Quality >S03036-02_A17.phd
11 7 5 6 4 6 7 3 5 7 10 6 7 9 9 9 14
10 6 5 5 9 7 5 9 5 3 5 5 5 7 9 8 6
9 13 11 8 14 19 12 15 11 10 6 9 9 5 17 12 18
22 18 18 15 14 9 17 18 9 9 9 9 22 31 42 35 35
19 24 19 20 13 37 33 33 41 23 35 31 34 29 34 24 37
37 37 53 53 53 35 35 35 40 32 32 38 19 30 27 31 35
38 53 33 50 28 38 14 19 15 28 23 28 23 32 32 28 26
26 34 31 24 32 23 18 23 28 40 37 24 28 19 14 19 14
14 19 14 14 18 19 18 18 11 16 16 13 11 13 9 23 28
28 33 40 40 41 53 53 52 57 47 50 40 40 34 11 14 10
14 33 25 14 12 7 12 40 40 18 14 23 14 14 42 53 32
40 40 18 14 11 27 38 29 20 14 20 19 33 40 39 32 25
14 19 13 23 40 23 25 24 34 32 25 37 40 24 24 16 18
30 41 38 40 14 9 9 25 34 19 23 32 11 18 37 50 14
12 14 11 14 20 11 19 37 19 19 23 31 14 11 38 14 23
10 19 40 34 22 40 34 16 24 24 16 22 42 33 18 23 23
23 9 21 18 19 38 31 40 23 11 19 23 24 31 38 23 28
40 34 35 19 28 18 41 42 14 8 19 27 24 47 19 38 37
38 24 10 10 13 23 40 40 21 17 21 19 12 13 21 40 14
11 13 40 22 19 23 23 18 34 40 9 9 19 22 10 9 9
27 31 22 19 10 10 14 10 9 9 8 9 21 24 37 30 20
37 37 23 23 23 14 24 11 14 15 11 23 24 23 14 34 10
40 40 35 40 35 26 28 37 31 37 37 20 27 46 37 24 23
26 18 19 17 12 23 22 30 37 25 9 23 18 34 24 23 16
8 26 23 13 28 40 28 14 23 14 19 18 17 11 11 9 11
24 18 14 11 12 44 33 29 13 17 19 24 18 38 35 23 50
37 16 10 14 11 9 9 9 12 19 16 9 11 6 8 11 6
11 10 7 10 6 11 9 8 9 11 9 12 10 9 13 25 9
16 12 13 16 20 18 14 11 16 13 14 11 18 7 10 6 7
14 18 9 14 11 11 9 11 13 11 6 9 9 10 12 9 6
9 24 10 14 16 13 11 6 8 6 10 12 13 11 6 11 10
23 9 11 11 14 11 18 7 11 11 6 29 9 6 14 9 12
25 14 11 11 6 10 11 8 6 9 11 11 6 6 12 8 10
13 17 12 11 8 8 8 14 12 11 8 9 6 8 13 7 17
26 20 17 16 24 17 9 40 18 14 9 12 16 11 6 6 11
9 11 12 11 16 11 9 6 9 9 9 14 9 10 6 11 9
9 10 16 6 9 14 11 11 16 15 22 12 8 10 11 6 11
13 10 9 11 14 10 10 11 18 10 10 6 11 10 9 12 22
22 18 10 11 10 9 11 10 9 13 10 10 9 15 19 11 14
11 10 11 10 10 10 10 16 32 10 6 6 10 12 10 9 9
13 9 11 9 10 19 9 12 13 11 13 8 8 11 9 14 26
10 10 9 8 9 9 11 11 27 19 25 14 21 9 9 11 6
6 10 9 7 10 6 6 7 6 10 12 11 9 10 11 7 8
8 11 9 9 12 13 19 8 16 12 12 18 13 9 9 18 9
13 9 11 10 9 7 9 10 13 13 11 9 25 11 11 7 10
10 9 9 10 11 35 14 12 7 10 16 13 19 15 11 14 11
9 17 9 10 10 34 20 19 9 16 6 14 32 27 16 11 9
9 6 7 18 9 7 9 6 10 6 8 7 10 19 11 13 7
17 15 9 9 16 23 23 35 9 9 18 21 16 16 9 18 8
19 12 10 9 8 11 9 6 14 8 10 11 10 12 14 11 11
13 10 11 11 11 12 11 29 11 19 14 24 13 22 11 17 14
11 14 10 10 11 11 10 12 14 11 8 14 11 11