S03036-02_A18
Seqid S03036-02_A18
Sequence >S03036-02_A18.phd
NNNNNNNNNNNNNNNAATTGGCGGCCAATCGGCCGAATTCCCATGGGGATCCGATGAAGC
CAACATAGGTTCGTTCAATTTTTAAAAAGAAGATGGTCCGGCCTCAGAATGTTCACTGGT
TTATCGCTACAATTGTATTTTTCATCGGATTTGTACACGCTAATACAGAATCAATCTTAT
ATAAGGTTCCTCACAACTTTCCCCTCAAAAAACCAAGAGACAGCTCTACTTATGCAAGAG
ATGTAAACTTGATATCTTCCATATCACTATCGGGAGAAGCAATGAGTCAGATCACTATCG
AGGCCAATACCACTGACTTGGAGTTGCATAATACTACGTATATTGAACTGGCGGACTTAC
AGCGAGACGAAACATATCAGATTAAAGTGTGTTGGTCAGCAATACATCCAATTTCCATTA
ATAATCTCCAAACTATCACAATACCACGTTTCACTGAATTTCAGGGAACTAAGTCAGACT
ACGCGAGAATACTAGTGACTTTCCAGGTCTTGTCTGACTCGTATCCTAGTGAGCATGCCA
TGGTTCCAATACAAGTCTCATTAATCACCACTCGGCTAGGTATCCCCGTGGATATTTACC
CAACATTAATCGTTATGGTGCTATTAGTAGCAGGGCTTGTTGTTACCCGGGCACCACNCG
TATTGAACGATCTTATGCTGAAATTATANTATGGAAAGCCTGAGCCNCCCTTTGGCTGGN
ATAGCTTGGCGCTNNTCACAACTAGAACTTTAANAANTCCATTAACCATCTAACTGCTTC
TCATGAAAGTGGGGANNTTTTTTTGAANGAAAGGAACATGAATAAATAAAATCACATCTC
TCTCCAAANGACAANTANGTCCGGAGAGGANNNGCAATGC
Quality >S03036-02_A18.phd
5 5 6 6 5 4 4 5 4 6 4 6 5 5 6 8 12
14 16 21 8 12 18 14 14 11 8 13 27 37 40 25 37 42
47 31 15 33 46 28 28 29 16 48 50 50 50 52 19 16 36
34 29 34 29 49 38 44 41 42 34 35 49 42 42 50 42 41
42 50 49 50 42 42 49 42 30 36 46 49 49 49 43 54 54
54 46 42 43 54 40 39 42 18 49 42 43 59 54 54 57 50
49 50 50 47 50 57 50 45 51 50 49 50 59 44 49 50 50
54 59 54 59 50 50 45 50 52 60 63 51 58 58 63 63 63
63 63 63 60 60 58 58 46 58 63 57 50 63 54 54 57 63
54 49 60 54 50 60 51 45 49 54 54 60 57 50 57 53 53
57 57 51 43 53 53 51 47 53 51 57 57 53 53 53 53 51
57 57 54 54 54 59 59 54 54 54 57 49 49 50 57 53 53
57 59 54 49 46 49 54 50 50 49 44 46 46 50 44 33 31
29 46 49 54 54 50 49 50 49 57 57 57 57 57 54 57 57
57 50 57 44 57 59 57 52 54 57 57 51 57 57 54 54 57
59 59 59 57 50 44 57 57 57 52 57 57 57 57 51 51 46
53 57 50 44 57 53 49 54 54 49 49 54 49 54 49 49 50
50 57 50 59 54 50 50 57 53 57 57 57 51 57 57 57 54
53 53 57 57 51 54 57 57 53 45 57 57 57 57 51 51 49
54 57 57 59 59 59 54 49 50 54 54 50 54 54 49 49 49
54 54 43 49 57 54 54 54 54 57 53 49 51 43 42 32 53
51 49 57 54 54 59 59 59 54 42 43 50 54 50 54 54 54
54 54 54 50 50 59 57 43 50 54 50 57 57 54 57 50 57
50 51 53 45 40 49 42 49 49 54 59 54 54 54 54 54 50
50 42 57 51 53 46 54 59 59 50 50 54 59 54 54 54 54
54 54 54 47 35 57 54 49 49 49 54 59 59 59 54 49 46
49 50 42 30 46 49 54 54 54 50 38 54 54 49 49 49 43
49 49 46 46 42 43 23 25 41 29 43 46 37 35 59 46 36
54 54 30 54 54 54 38 54 49 49 35 50 43 46 35 39 46
46 54 50 49 35 32 54 49 49 35 50 30 35 49 30 43 38
49 49 52 50 49 50 42 21 49 35 35 52 52 46 49 49 33
43 33 42 49 49 46 35 35 33 30 27 28 35 49 40 40 35
52 35 51 22 49 46 46 30 37 35 33 33 21 28 28 35 30
35 49 33 28 27 30 30 28 28 32 42 36 21 30 37 28 37
32 32 32 30 30 40 46 36 46 27 23 20 10 16 20 18 21
15 21 28 25 10 25 16 21 12 17 24 32 31 32 36 32 34
28 31 27 28 28 34 21 26 18 28 13 30 19 14 12 13 21
10 29 26 19 35 30 34 28 27 34 17 26 28 28 28 30 42
30 32 25 40 40 33 30 32 35 16 15 6 17 8 30 30 40
42 34 30 28 25 27 35 29 26 24 8 8 10 21 18 32 30
35 37 24 14 20 10 16 32 7 9 17 17 13 17 14 36 16
12 12 20 21 13 19 13 12 10 6 9 12 28 23 23 26 15
15 11 16 15 25 7 21 19 29 17 15 16 16 38 26 10 8
8 11 6 6 9 18 24 18 31 24 18 18 20 15 25 22 10
9 21 15 9 13 6 16 12 6 19 14 28 14 30 31 18 31
31 18 25 24 16 12 12 15 14 14 29 24 27 29 23 8 16
13 14 9 28 9 17 17 22 30 24 14 13 12 6 6 28 30
32 31 14 11 13 13 11 13 6 11 12 16 20 12 16 8 18
13 16 13 12 10 17 10 15 12 8 13 10 26 14 12 14 13
16 11 9 11 21 17 11 8 12 9 10 23 20 14 14 6 10
11 9 9 9 6 10 8 7 9 12 9 10 9 9 14 28 8
20 29 17 1 1 1 20 14 14 14 19 13 11