S03036-02_A19
Seqid S03036-02_A19
Sequence >S03036-02_A19.phd
GCNNNNNNNNNCGATTGNNGGCCAATCGGCCGAATTGGCTAGACTTTATTGACTCGTATA
TTTCTAACGAATAAATCACCCACTCTTGCTATCCTAACAGTATTTAATATTAGCTATTTA
AAAGCCTTAAGATGGACTATGGCTACTTTTTTCCCGCACAACGTATTGAAGAAACAAATG
GTGTGGATTTTTGGATAGACAGTAATGCTGAATTTACACAGTCTAAAAGACCTGACTCTT
CAACATCCACTCTTTCAAGGGTTTTAACGGACACCACGAATGTATCCAATAATAGTGGAT
CACTGAAAAGAAAAACCATCAAGAACAAAATATTCCCACAAAGGAAAATATTCAACGATA
GCGAATATTTTGACTTTGGTAAAGCCAACACTGATTGTAAGCATGTGTTTAAAAGTATTT
CTAAGCAACTGATTTTTCTTCCAAGGTGTTTCCAACATCACAGTATCCGAGGCTGGATGA
AAGACAGATACTCCGAATTTGGTTATAAAATAAAAAGAAATCAAAATTGTCCCCNCTCAG
CATGTGTACAGGCACTATACAATACTAGTAGATCCAATACCGAAGAGTCAAACCCCCAAC
AGTCTTGNATCTCTGATAATGTATAAATACATGCAATACTCTGAAAAAGAGAAAGGAATT
GAATGTGCAGATTTTTGCCAGGGGAAATAATTGGGATTCTNNNCTGAAAACTANCTTAAN
ACANTTTAGTCTTTGCGCACGGCATTTTTGTCTGAAATTTAATCCTCACAACTTTATNAC
AATTTCGAGGTCTAAACCTGTTAAAAATCCAAGGGAAAACTTTAATTTNCNANNTTTCAN
GTATTAAAAGNNNCCAGAAGTTTNNCTAAAAGAAGTTTTGAACTCCTCTTTCCTGTAAAC
C
Quality >S03036-02_A19.phd
8 8 3 4 4 5 4 3 5 5 7 8 14 15 13 15 10
6 7 32 22 14 15 23 16 25 40 40 18 28 26 30 44 17
25 31 28 12 18 30 44 35 20 18 35 46 32 21 35 50 44
42 27 26 27 21 31 47 41 46 42 54 32 29 30 35 32 28
18 42 50 54 59 43 38 30 38 33 32 39 28 36 44 39 42
34 50 43 39 28 50 39 39 39 39 43 42 44 44 50 42 42
44 60 44 44 60 60 47 44 44 45 47 60 50 54 47 60 44
50 54 60 50 35 44 39 32 45 54 54 51 53 50 53 51 44
44 50 54 57 57 45 50 46 34 44 39 53 49 50 54 39 39
35 42 43 54 42 59 50 59 54 49 49 54 50 51 53 53 46
49 52 54 50 54 47 49 46 45 51 54 54 54 54 54 50 52
42 52 49 49 51 51 49 51 49 49 54 50 37 50 54 38 43
42 42 50 42 46 54 46 35 42 54 50 35 40 32 35 31 49
28 35 28 54 49 49 49 47 42 30 54 59 57 42 42 35 37
35 46 31 30 49 43 49 54 46 42 33 43 35 35 38 59 32
27 25 54 57 57 50 54 46 46 42 54 27 32 29 46 39 43
35 35 30 35 46 35 57 50 52 57 46 49 35 28 29 36 54
51 52 54 49 51 49 49 51 49 31 21 43 32 35 35 51 49
49 54 54 54 54 54 46 46 43 46 46 32 46 42 35 35 46
50 49 46 35 59 54 46 46 54 42 43 43 33 29 31 33 30
54 54 54 57 42 50 49 49 42 50 44 26 19 17 37 43 37
54 49 49 30 35 32 54 59 41 54 49 46 45 46 49 50 32
46 46 54 54 43 37 46 46 51 35 29 31 20 54 41 35 46
50 50 42 42 54 54 32 38 46 40 46 43 54 54 54 54 54
43 43 35 31 27 31 35 38 43 35 37 32 28 32 30 50 18
32 27 54 30 54 54 54 24 46 54 38 38 35 32 35 28 30
28 35 38 50 21 50 30 42 17 17 15 28 42 33 33 42 33
37 34 42 35 32 42 31 24 22 23 54 34 49 34 42 50 54
38 28 46 42 42 49 24 38 21 42 19 50 30 19 24 18 30
28 24 12 11 9 11 31 39 42 34 43 38 44 30 52 54 54
37 35 34 33 42 35 29 37 32 31 22 19 9 34 38 50 44
50 59 44 21 27 28 29 7 33 33 30 29 20 18 24 35 44
21 42 19 16 18 16 32 35 25 16 27 26 35 50 42 29 17
14 16 20 30 38 22 33 18 21 18 33 19 12 15 12 12 18
20 27 29 14 17 22 20 30 18 16 24 31 30 35 30 44 44
30 29 29 8 16 31 21 33 29 11 8 11 7 10 12 17 13
26 30 30 36 32 27 33 27 33 16 16 16 17 35 42 35 27
24 17 32 33 13 9 20 17 33 20 21 16 28 17 21 27 17
27 21 13 11 11 14 28 27 29 25 16 30 18 31 28 10 16
21 22 23 27 25 16 9 23 9 37 34 32 30 20 13 19 15
28 31 24 29 30 34 22 22 13 25 10 38 15 34 11 11 11
12 18 10 6 6 7 29 28 17 30 14 21 14 19 20 13 7
18 20 17 27 27 7 21 25 19 5 15 22 9 21 11 16 22
19 19 34 25 16 18 15 16 15 18 21 13 23 23 30 31 31
30 27 27 26 26 13 20 21 12 18 50 32 20 11 10 14 26
15 10 15 10 19 15 20 20 39 46 27 16 6 10 16 12 18
14 17 17 27 17 8 9 12 31 31 25 30 18 16 12 20 30
31 31 27 21 32 31 36 9 20 10 11 9 9 15 18 19 23
34 21 19 14 11 15 30 23 17 12 26 29 6 9 6 10 6
6 8 14 10 14 18 7 10 12 11 16 18 10 16 22 27 12
6 6 7 20 28 25 27 24 13 15 16 12 10 6 6 11 10
13 11 16 17 8 29 35 11 21 12 21 13 20 20 17 18 22
13 16 11 10 12 16 14 11 15 17 25 16 9 9 10 16 8