S03036-02_A20
Seqid S03036-02_A20
Sequence >S03036-02_A20.phd
TNNNCNNNNTAGGNCGATTGGCGGCCAAATCGGCCGAATTTTTTTTTTGATGGATACGGA
AGCATTGGCCAATTATTTGCTACGGCAGCTTAGTTTAGATGCGGAGGAGAATAAGCTAGA
AGATCTTCTCCAACGGCAAAATGAAGATCAAGAGTCTAGTCAAAAATATAACAAGAAATT
ATTATTGGCATGTGGATTTCAGGCCATTTTAAGAAAAATTCTGCTGGATGCTAGAACAAG
GGCAACCGCAGAAGGTTTGAGGGAAGTATATCCTTATCATATTGAAGCTGCAACGCAGGC
TTTTCTGGATAGTCAATGAAGGGGTATTTTTAAGCCTCTTTATCATATACTCTTTTGTTC
GTAATAGCAAATAACTCGGTTTTATTAACGAGAAAAAGTTAAAGCATCTTCTGAATTTTT
ATTATATACAAGTTATGTAGTAAGGCGCCACTTAGCACCTAGAAAATATGATTAGCGTTC
CGTNNTAAANANNAAANGTGANANAAAGAANAAAAAAAAANNANGANAAANNGGTACCGG
CCATAAGGGCCAGCTTGAGTATTCTANNGTGTCACCTAAATAACTTGGNGTANNATGGTC
ATAGCTNNNNCCTGTGNNNATTGTTTNCCGCTCAGAATNNNCACAACATNCNNNCCGNNN
GCATAAAGTGGNANGGCNGGGGTNCTANTAANTGAGNTCANNNACNNNNNTGNGNTGNNN
NAGTGNCGCTTTGCGTAGNNAAACTGAGNNGNAANTGAANNATGNANNNCNNNCNCANGN
NNAANCGGAGANGNAANNGNNNNNNANCATNNNNNNTNNTNANNAANNNGANGGANNANC
AGACGAGGNNNGCN
Quality >S03036-02_A20.phd
8 6 5 4 10 4 3 4 5 14 11 8 13 6 24 14 9
10 37 30 12 17 37 18 26 28 17 29 35 31 42 42 25 47
47 47 52 17 26 52 52 47 52 52 52 47 47 43 32 31 26
51 46 17 23 47 35 49 49 51 49 49 49 41 42 52 36 19
31 38 31 46 43 43 49 42 52 49 44 52 43 46 50 42 39
54 59 59 59 54 50 57 59 54 54 43 44 49 57 42 52 57
59 53 33 38 54 42 42 50 44 44 54 54 50 50 50 54 59
54 54 54 41 30 57 57 59 57 49 49 44 44 59 59 59 59
54 54 54 54 49 44 50 54 54 54 41 41 59 59 57 57 57
59 57 57 57 57 57 54 54 54 54 54 59 57 59 57 57 54
59 57 54 59 57 57 53 57 51 53 59 57 57 59 57 59 57
45 49 54 57 53 53 57 57 57 44 57 57 57 51 59 57 57
53 54 57 57 57 51 49 57 54 57 54 54 54 50 50 54 54
49 45 44 43 34 34 30 44 50 52 57 49 57 57 50 59 59
57 57 59 45 57 59 54 50 54 54 54 54 54 57 50 46 57
54 57 53 57 57 54 59 57 57 54 50 54 50 44 54 57 54
49 50 50 57 51 45 46 49 57 57 59 57 54 51 57 51 51
50 54 54 54 57 59 54 54 38 50 49 43 43 51 51 46 46
53 50 42 33 50 50 54 54 42 49 46 49 40 41 49 49 49
49 36 31 30 54 49 49 49 46 50 54 49 46 46 40 46 43
47 49 54 54 38 54 59 54 54 49 49 49 49 49 49 49 52
30 49 49 49 37 54 59 54 54 37 46 43 39 50 37 43 49
46 52 50 42 42 35 49 47 47 46 32 49 37 49 49 52 52
46 50 47 49 46 40 37 46 52 36 46 42 49 52 52 52 52
46 40 35 46 50 49 45 35 42 31 35 46 49 42 49 46 49
49 49 49 49 31 42 30 49 49 28 41 50 50 41 41 22 16
23 49 50 23 44 40 36 32 36 37 40 40 41 46 36 26 46
35 46 30 32 40 33 36 32 41 46 50 46 28 37 36 30 42
35 29 33 28 34 28 21 3 3 11 23 11 25 5 9 5 7
10 9 10 6 10 9 9 14 7 13 5 9 13 21 10 12 9
6 19 12 16 23 18 12 10 21 14 7 7 8 5 9 13 5
8 21 17 5 5 10 23 19 16 21 16 25 24 19 30 17 15
15 21 21 40 25 27 27 15 12 16 36 18 24 28 18 20 15
12 11 16 16 12 7 7 9 11 27 30 28 11 19 13 13 23
36 15 12 10 8 11 13 13 23 19 7 8 9 10 5 5 10
20 29 20 14 15 13 18 19 13 16 12 5 5 5 5 9 21
28 34 11 20 6 5 5 10 13 11 12 13 11 10 6 11 13
25 14 18 12 13 10 11 19 11 5 5 5 10 11 13 18 28
17 11 20 7 10 6 6 5 14 8 9 5 7 6 12 17 12
21 28 12 27 16 9 23 11 6 8 7 11 9 10 7 17 13
10 13 9 5 9 14 10 6 9 10 10 5 13 15 12 10 6
10 9 10 6 5 5 9 10 7 5 6 6 7 8 12 6 9
6 12 10 7 7 7 5 9 11 9 10 5 11 25 12 15 14
15 11 9 12 9 10 11 6 6 8 21 28 19 16 19 9 12
6 6 12 6 12 12 6 12 14 15 9 5 6 26 10 9 5
9 7 5 5 10 7 7 6 14 6 16 11 6 9 6 6 6
11 12 5 11 10 14 12 9 9 7 8 6 9 9 5 7 8
5 6 6 6 6 5 15 7 11 12 10 7 5 7 5 7 5
10 6 6 9 6 8 6 6 9 10 5 7 5 15 23 6 16
15 10 7 6 9 6 8 10 14 12 9 16 11 9 10 6 7
7 9 9 6