S03036-02_B01
Seqid S03036-02_B01
Sequence >S03036-02_B01.phd
NNNNNNNNNNNNNTNTNANNNCCCNNNNNNNNNNGGNGATTGNGNGGCCAATCGGCCGAA
TTTGGGGTCCGAGGCTCTCGCAATGATAAGGACTTTGTGACGAAGTATACCGCAGATTTA
TCACAAATAACTTCACAAATCCATCAATTAGATGTCGCGTTAAAGAAAAGCCAATCCATC
TTGAGTCAATGGCAATCAAATCTGACCTTTTATGGTATTGCGTTTACGGTATTGGCCCTG
AGCTATACATATTGGGAGTACCATGGTTATCGACCATACCTTGTGGTGACTGCGCTACTA
TCCATAGGCTCGCTAATCTTGTTCAAATGGTCATTAACCAAACTCTATGCATTTTATAAC
AACAATAGGTTACGCAAGTTGGCAAAACTCCGTGCAATTCATCAAAAGAAACTGGAAAAG
TTAAAGGAAGAGACCCACTATAATGCTACAAGCTCAATCATCCAACGGTTTTCTTCCGGT
GAAGATCAAAACGACGATGCCATGGTACTTCTAGATGATGAATTAAATGCTAAATACCAA
GAATTAAACAATCTGAAGACAGAGCTAGAAAAATTTAAGAAGGAANCCATGTAAAGGGCC
TAAAGAAGGAAGACAGCGATGCATGGTTCGACAAAATCATCAGCGTACTGGCAGGCGGTA
ATGAATTGGACTCAACAAGTTCGCTCTCTCCCTTCAAAAAAATCATATGTACACAGTGTC
ATTGNAATCCAATTGCTACAGATTGGCCAGNAGCCAATCATCTTATCTGTNNNNCTGTAN
CNCNAATAGACGANTAANNAANANAANNACGCCATGAANGCAAAACAACCNGNACAGCCT
CNCANTGNGANAANNAAAAAANAAAATGATTN
Quality >S03036-02_B01.phd
4 3 3 4 3 2 4 3 2 3 4 6 6 9 6 8 5
8 7 3 7 8 12 13 5 3 3 5 5 3 3 3 7 7
19 20 6 16 10 16 27 18 6 10 7 15 15 12 14 10 8
29 35 48 19 18 33 34 25 15 31 49 31 36 30 36 31 18
46 29 42 52 42 43 41 51 47 47 42 42 34 42 35 37 49
26 34 50 43 49 49 24 21 49 49 49 54 43 50 33 27 38
50 50 44 50 44 42 43 43 49 33 42 42 33 42 36 49 44
54 54 50 54 59 50 49 49 54 54 54 50 54 54 45 50 51
50 54 50 54 54 45 44 49 49 54 54 54 50 44 43 45 44
57 57 52 52 50 59 57 45 49 53 43 51 53 53 53 57 51
42 51 57 57 51 51 51 50 57 57 57 51 47 51 52 51 50
54 54 57 57 57 54 53 57 57 57 49 53 53 53 53 53 53
45 44 53 53 53 53 45 57 57 57 53 54 57 57 51 53 50
57 57 53 51 49 52 57 57 50 57 57 57 53 45 50 49 49
50 52 45 44 46 29 32 38 43 49 49 49 57 57 57 57 53
51 57 54 57 50 45 49 50 51 57 57 59 57 54 57 57 59
57 50 57 54 59 57 57 57 59 57 57 57 57 57 59 59 38
42 57 57 51 53 57 57 59 50 52 54 57 53 51 50 59 59
59 59 59 59 57 54 57 42 50 54 54 57 59 54 57 54 57
54 42 53 51 53 53 57 54 53 54 54 57 54 57 59 57 50
59 59 59 59 59 59 59 59 59 57 54 57 57 57 57 54 54
49 51 57 50 54 57 35 49 57 57 53 43 49 57 54 43 57
59 57 57 57 57 53 51 46 46 59 59 54 49 54 59 54 46
49 54 57 54 49 51 49 52 51 49 52 52 52 52 53 53 52
52 52 52 50 52 52 52 50 53 53 52 50 46 49 43 52 52
52 53 52 53 49 52 52 42 35 49 49 52 52 52 52 52 43
52 52 52 52 52 52 52 40 52 52 52 52 50 37 53 49 49
51 51 46 45 33 29 35 40 49 30 30 40 49 46 50 49 37
46 49 52 41 50 43 50 46 43 31 50 46 50 52 52 42 49
50 51 50 52 41 51 49 52 46 49 52 51 49 49 35 52 53
37 49 37 49 49 32 49 35 29 49 49 45 32 49 43 50 49
42 46 34 46 49 51 51 35 40 49 40 32 39 46 39 31 28
49 34 50 49 50 34 49 49 49 40 50 49 49 50 36 26 28
52 52 29 46 40 34 46 37 25 32 37 20 17 43 40 26 51
35 45 35 29 49 10 14 7 22 45 31 35 50 30 32 30 45
43 43 28 14 49 29 15 18 37 37 30 45 15 51 31 41 35
34 30 28 36 29 37 44 35 36 23 32 31 43 37 17 41 30
40 33 35 26 45 51 34 35 30 29 41 31 37 26 31 31 30
26 24 33 40 25 31 31 16 50 30 24 50 29 31 30 20 31
18 46 18 21 25 14 32 18 41 32 12 21 17 23 19 19 20
15 18 28 34 41 29 35 25 31 21 14 14 13 12 9 16 22
22 20 20 17 15 14 30 28 23 35 30 35 22 8 36 16 31
17 35 28 42 23 35 18 31 14 10 3 9 15 12 10 18 9
42 15 26 15 10 10 8 12 12 26 21 13 14 22 20 16 25
17 24 7 14 10 12 15 12 29 26 25 12 29 23 20 17 15
30 16 34 28 25 5 3 5 7 16 31 26 22 20 6 14 7
17 5 20 20 22 30 13 30 18 11 15 5 16 29 14 6 5
9 10 7 8 7 9 21 7 7 13 10 11 21 24 8 17 9
11 14 5 14 14 29 25 23 27 9 24 20 9 22 6 14 6
23 18 13 10 10 8 10 8 6 9 10 6 10 11 6 27 32
6 25 14 5 5 13 22 18 18 37 23 7 8 15 13 9 10
8 12 19 24 7