S03036-02_B02
Seqid S03036-02_B02
Sequence >S03036-02_B02.phd
GGNNNNNNNNNNNNNAAGNNCNCGNCANAAAANGATTGNNGGGGNGGGCGGCCGAATTCC
CATGGGGATCCGATTGATCATCAAACAAGCAACTACAAAAAAGCTTTACTGACAACTCAC
ACAAATAACACAAAAAACAAAAACTTCAACAATGGTCGCCTTTTTAGAACTAACTTCTGA
CGTTTCTCAACCTTTTGTCATCCCATCTCTTTCGCCAGTCTCTCAGCCAAGCTCAAGAAA
GAACTCTGACGCAAACGTCGATGACCTGAATCTGGCTATTGCCAATGCCGCTCTTTTGGA
TGCCTCTGCTTCAAGCCGCTCACACTCCAGAAAAAACTCTTTGTCTCTGTTGTAAGTGTT
GTACACGAGAATTAACACACTATTAGCATAAAAGACATTTGGCATCTTTACTTACTTGGG
CAAGTAAGTCACGTACTTTTTTTTTTTTTCCGGAGCATTCATTGTCATTCTATCTGCACT
TTCCCGCACTTACATTCAATAACCTCGGATCGGGTCTCTTCTACGACAGAAACTTTTTGA
TATATACAAATTTATGCAANATAAATACGGAGAAANTAAAAAAATTTAGAATAAAGANCN
GNACNAAAGGTNGNAGGGGGAAAAANNGAAGAACAAGGAAAAAAAGNTATANTATGANCC
ATGNAANGGNAGGNGGGNTNATGCGAATGGGGCNGCTAAAAAGNTGAGAAAAAAAAGGAC
GTTGTTATCTNNGTGGCCAGGGGGTGAGGNGGGAGGGGAATNANTNNTTAGCCNTCAGAT
GAAATANNAGCAGGGGNGNCGAAANGCTGAGNAGNGAGAGTAAGAGTGCGAGTGAGTGGN
CTGGNTNNNATNGNN
Quality >S03036-02_B02.phd
14 9 5 6 7 6 5 4 4 5 4 5 5 5 7 8 9
8 3 3 9 6 8 8 7 14 12 6 14 16 9 8 5 8
15 18 16 16 7 7 12 13 9 13 6 12 9 9 13 37 18
12 15 18 20 9 14 14 10 9 10 9 21 42 40 35 28 11
21 15 21 30 44 20 23 39 16 18 18 19 26 23 20 19 24
44 17 44 44 35 34 60 42 46 44 42 20 35 35 35 25 31
46 46 46 47 32 46 41 34 60 26 31 31 33 42 39 29 31
24 28 41 31 34 34 39 41 60 53 53 53 53 53 60 53 53
53 57 45 46 46 53 42 52 57 57 52 46 46 53 39 53 60
52 53 53 52 52 52 57 53 60 57 60 52 52 57 57 53 53
53 37 60 57 57 53 52 52 57 52 52 52 57 60 52 52 53
52 53 47 53 60 60 53 53 53 60 53 57 57 57 57 57 52
52 60 57 52 57 57 60 57 57 52 52 52 53 52 52 52 57
57 52 57 52 60 57 52 45 53 53 52 53 53 45 47 53 53
33 38 38 42 23 21 38 42 45 53 52 52 53 52 60 53 53
53 60 60 57 57 52 52 57 52 52 60 57 52 52 57 53 57
60 60 52 52 52 60 52 60 52 52 52 52 60 60 57 52 60
52 52 52 57 57 57 60 60 57 57 52 53 53 52 60 57 57
57 57 52 57 57 53 53 53 57 57 60 57 52 53 60 57 53
37 53 44 44 38 53 57 53 39 53 53 60 52 52 60 60 60
60 57 57 60 60 60 53 53 60 60 53 57 53 57 57 57 57
52 42 57 52 53 60 60 53 52 57 52 52 53 57 53 52 52
57 57 52 57 57 52 52 63 63 53 57 54 52 57 60 60 60
60 52 57 52 45 57 52 60 57 57 52 57 60 53 45 53 57
52 57 60 57 57 60 57 57 57 57 60 52 52 57 60 60 57
52 57 57 57 40 52 52 48 48 40 52 60 60 60 60 60 57
57 57 57 60 60 57 60 47 37 37 47 47 32 32 35 40 60
40 19 21 27 34 24 20 18 47 52 47 47 47 52 42 42 46
32 23 32 35 40 40 42 37 35 37 29 28 18 35 34 35 37
30 32 35 24 13 15 42 41 41 35 30 37 47 34 40 35 20
42 46 43 35 27 30 30 22 39 52 47 35 17 19 20 16 17
18 14 35 44 35 19 24 27 21 29 47 53 45 25 28 9 13
27 23 16 13 8 13 41 32 25 18 24 28 27 16 8 6 10
19 11 35 19 33 29 24 11 40 21 19 17 22 11 6 8 10
26 30 14 28 16 24 9 18 16 10 12 16 27 18 11 9 11
10 11 6 10 7 8 6 9 11 6 10 10 14 11 9 11 7
9 6 12 13 16 14 11 10 9 9 11 11 14 7 6 11 15
11 19 11 10 9 9 24 11 13 14 10 9 21 19 22 23 10
6 9 9 10 10 6 10 9 11 13 11 7 11 10 10 9 9
7 18 19 7 9 11 6 8 9 10 6 11 14 31 7 11 6
13 21 10 10 11 11 10 10 14 9 18 9 11 7 10 9 10
8 11 11 15 9 9 7 11 18 9 18 17 14 38 28 24 20
15 14 10 22 14 15 10 11 11 10 9 10 9 10 11 11 6
7 10 8 15 15 14 10 9 10 10 11 21 10 10 9 9 9
9 6 10 14 9 9 9 9 11 10 12 11 8 6 9 7 11
7 6 9 11 11 14 11 11 7 11 9 17 11 10 10 10 11
23 13 14 10 6 6 10 9 11 9 9 14 8 11 6 10 7
14 9 21 12 11 6 8 9 9 19 9 10 6 10 11 6 8
9 14 14 8 8 8 8 8 9 14 8 11 11 10 11 8 9
10 9 10 9 8 10 7 10 11 8 10 6 9 7 6 6 8
9 5 10 5 5