S03036-01_B18
Seqid S03036-01_B18
Sequence >S03036-01_B18.phd
NNNNNNNNNNTNTTTATGGNNNCANNNANANNGNGNNTTGNGCGGCCAATCGGCCGAATT
GAGGGCGATGCAACTAAAAAACATATAAATTGGAAATTACGAGACTTTCGGCACAAGAAG
CGCTAATATCCTACTTAAGTGGTTGAATTCTTGTATGATTAAAAAAAAAAAAAAAAAAAC
ACCCGTCTTATTTTCAATTTTATGGTACTGACTTTGAGGGTACGTAAATCATCGAAGGAA
ACATAATTGCACTGATATGTAAACTTCCTAGTTTCAAATGTTTTCTCGGAATACCAAATA
ACCTCTAGCCATAAGTTTATTTTCAAACTTTTTCCTCTTAGGTGATAAGGGAAATTAGAA
AGAAAGAAATATTTATTATTGAAATAACTGTCCAAAGAAGCAAAGTGAATATAGAAGAAA
ATATGCNAGTATTTACGATTTTTTATTTAGCTAAGTAACCAACGTGGTGCCCTATTCACG
ACATAGCAAGTGTCCATAGGTGCATGCGTTTTCTTTAATATCATNGTGTTNTAANTATTA
AAGGAAGGGAAACGNAANTGAAATTANATGTANAGAAAAGAAANATAAAACAAACCANTA
ATTNCNCCCGCAGGGCNCGGGNGATGGNAAAAAGGNNANTAATTTGTTTTNGCNAAATCC
GGAGAAAAGCCAANACGGGGGGNAAGNGGGGTGGGGGTGGAGATTGAAAAAAAAAAAAAC
CTTACAANNAAAGGGCAGGGGNGGGNNNNGGGGANAGNNGNNANTATTAATATNATNNAT
TACNAAATANGGGGACNAAAAGAGNNAANANTGANGTNGATNTAATAAANNNNAATAAAT
NNNNTACACCCANCAAACNNNGGNGNANGGGCGAAAANNNAGAGNTANAAAAATAG
Quality >S03036-01_B18.phd
5 4 4 3 3 3 4 4 4 7 12 5 10 11 10 9 8
9 9 5 6 7 8 8 5 5 3 8 5 8 6 7 8 6
10 6 7 9 17 11 5 14 15 18 17 16 10 10 9 31 32
35 30 38 34 31 29 20 27 28 21 13 13 30 23 26 40 35
15 32 33 18 17 28 32 43 47 40 43 43 35 28 32 42 42
42 30 31 22 32 35 43 50 44 42 35 33 42 35 30 12 33
24 33 46 52 47 42 52 46 52 46 44 47 41 35 40 48 43
57 52 52 52 52 44 47 46 46 57 57 60 52 60 52 48 48
48 57 57 48 57 52 57 60 60 52 60 53 53 57 60 57 60
52 60 52 60 53 52 52 52 60 60 60 60 60 60 60 60 60
60 53 53 53 60 60 53 53 53 60 57 57 60 60 53 37 38
44 52 57 57 60 60 57 52 52 53 60 60 60 52 57 52 53
53 44 53 52 57 53 53 53 57 60 57 52 52 52 60 53 42
37 52 47 53 60 53 42 42 53 42 53 53 42 42 38 42 60
53 53 37 44 42 42 42 47 38 44 53 57 53 53 53 53 41
53 53 46 53 53 60 60 53 53 53 53 53 53 53 52 53 53
53 53 53 53 46 53 53 53 58 58 57 57 53 42 53 53 53
53 53 53 53 52 52 53 53 60 60 53 60 57 60 53 53 37
53 53 60 53 53 53 53 53 53 53 60 53 53 53 53 60 60
52 50 53 53 53 53 53 60 60 53 53 57 57 53 53 53 53
53 42 27 40 35 53 53 53 53 53 53 53 53 37 46 44 46
46 53 44 44 53 53 42 42 44 53 44 44 37 53 52 57 53
53 46 53 53 57 57 53 46 46 42 53 53 29 29 42 53 46
42 46 42 46 44 53 60 53 42 44 29 46 53 42 42 46 57
52 37 46 53 53 53 53 46 42 53 46 46 53 53 42 45 44
16 6 25 53 53 53 53 52 53 35 37 35 53 52 60 53 57
57 42 42 53 53 60 53 40 42 26 14 44 29 42 39 37 38
28 15 30 30 37 35 53 38 24 27 27 21 10 16 23 23 24
25 14 37 14 23 28 19 40 14 9 10 18 14 28 11 14 9
10 19 21 9 18 14 11 14 32 16 11 18 24 11 20 16 20
33 18 14 9 14 9 10 11 14 13 18 9 11 11 7 11 13
14 18 11 7 12 9 16 6 8 8 8 9 18 13 16 10 9
9 9 9 10 9 9 9 9 9 9 6 10 13 7 9 16 10
11 17 16 10 10 7 10 12 24 9 10 6 14 8 11 13 14
14 12 16 17 14 6 14 9 10 9 9 9 9 10 8 26 13
10 10 7 11 10 9 11 9 7 9 6 9 11 11 9 9 9
11 10 9 11 6 14 18 11 9 7 11 13 16 10 13 7 10
20 10 11 9 8 9 6 6 9 6 11 9 11 9 11 9 10
10 11 18 9 6 10 9 6 14 9 10 13 12 17 12 10 13
10 12 10 13 12 9 11 10 10 11 6 9 11 11 14 9 19
16 18 6 9 15 8 6 9 9 11 12 9 12 34 13 27 17
14 9 10 11 12 10 13 11 10 13 13 18 20 12 9 14 19
16 28 14 16 9 11 10 11 11 9 9 10 9 6 7 10 14
16 11 10 9 11 8 14 9 13 10 7 16 31 16 7 6 7
6 14 12 9 11 9 7 9 9 6 7 18 6 6 9 7 9
11 11 8 9 22 18 46 10 6 9 8 6 7 9 13 28 14
12 7 12 12 31 14 22 7 12 8 9 9 9 9 6 9 11
9 9 18 15 9 6 6 16 16 6 10 6 9 14 9 6 9
13 6 9 9 9 7 8 10 9 9 9 9 11 6 6 6 6
13 28 10 22 10 10 9 6 6 7 7 9 11 9 12 14 14
9 14 6 9 13 11 10 10 6 6 7 11 9 6 9 7 9
6 13 14 17 9 23 9 8 12 8 6 6 7 9 21 9 14
7 9 11 7 8 9 16 13 9 11 16 11